Stem-loop sequence hsa-mir-34b

AccessionMI0000742 (change log)
Symbol HGNC:MIR34B
DescriptionHomo sapiens miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

463 open access papers mention hsa-mir-34b
(2562 sentences)

Stem-loop
        cg    -gua       uca    c        -  g 
5' gugcu  guuu    ggcagug   uuag ugauugua cu u
   |||||  ||||    |||||||   |||| |||||||| || g
3' cacgg  caaa    ccgucac   aauc acuaacau gg g
        aa    acua       cuc    -        u  u 
Get sequence
Deep sequencing
6701 reads, 43.8 reads per million, 137 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403), miR-34b (MI0000404) and miR-34a (MI0000584) to clarify homology with human sequences. The predominant mature miRNA in human is expressed from the 3' arm (in contrast to previous annotation) [2]. Both arms express mature products in mouse.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 111512938-111513021 [+]
sense
OTTHUMT00000319352 ; SIK2-001; intron 3
ENST00000304987 ; SIK2-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-34b
hsa-mir-34bchr11: 111512938-111513021 [+]
hsa-mir-34cchr11: 111513439-111513515 [+]
Database links

Mature sequence hsa-miR-34b-5p

Accession MIMAT0000685
Previous IDshsa-miR-34b;hsa-miR-34b*
Sequence

13 - 

uaggcagugucauuagcugauug

 - 35

Get sequence
Deep sequencing3518 reads, 126 experiments
Evidence by similarity; MI0000404
Database links
Predicted targets

Mature sequence hsa-miR-34b-3p

Accession MIMAT0004676
Previous IDshsa-miR-34b
Sequence

50 - 

caaucacuaacuccacugccau

 - 71

Get sequence
Deep sequencing3180 reads, 90 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).