Stem-loop sequence hsa-mir-34b

Accession MI0000742
Symbol HGNC:MIR34B
Description Homo sapiens miR-34b stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     cg    -gua       uca    c        -  g 
gugcu  guuu    ggcagug   uuag ugauugua cu u
|||||  ||||    |||||||   |||| |||||||| || g
cacgg  caaa    ccgucac   aauc acuaacau gg g
     aa    acua       cuc    -        u  u 
Get sequence
Deep sequencing
249 reads, 19 experiments
Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403 ), miR-34b (MI0000404 ) and miR-34a (MI0000584 ) to clarify homology with human sequences. The predominant mature miRNA in human is expressed from the 3' arm (in contrast to previous annotation) [2]. Both arms express mature products in mouse.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 111383663-111383746 [+]
sense
ENST00000540312 ; AP002008.1-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-34b
hsa-mir-34b chr11: 111383663-111383746 [+]
hsa-mir-34c chr11: 111384164-111384240 [+]
Database links

Mature sequence hsa-miR-34b-5p

Accession MIMAT0000685
Previous IDs hsa-miR-34b;hsa-miR-34b*
Sequence

13 - 

uaggcagugucauuagcugauug

 - 35

Get sequence
Deep sequencing 127 reads, 10 experiments
Evidence by similarity; MI0000404
Validated targets
Predicted targets

Mature sequence hsa-miR-34b-3p

Accession MIMAT0004676
Previous IDs hsa-miR-34b
Sequence

50 - 

caaucacuaacuccacugccau

 - 71

Get sequence
Deep sequencing 122 reads, 13 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).