Stem-loop sequence mmu-mir-219a-2

AccessionMI0000741 (change log)
Symbol MGI:Mir219a-2
DescriptionMus musculus miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Literature search

47 open access papers mention mmu-mir-219a-2
(469 sentences)

Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag uggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
251053 reads, 464 reads per million, 99 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 29845631-29845727 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-219a-2
mmu-mir-219bchr2: 29845647-29845711 [+]
mmu-mir-219a-2chr2: 29845631-29845727 [-]
Database links

Mature sequence mmu-miR-219a-5p

Accession MIMAT0000664
Previous IDsmmu-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing56690 reads, 91 experiments
Evidence experimental; Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-219a-2-3p

Accession MIMAT0022841
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing222350 reads, 43 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).