Stem-loop sequence hsa-mir-219-2

Accession

MI0000740

Symbol

HGNC:MIR219-2

Description

Homo sapiens miR-219-2 stem-loop

Gene family

MIPF0000044; mir-219

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Stem-loop

a   a       c     u   u     aa           uac a  c 
 cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
 ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
 ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
-   -       u     u   -     cg           caa -  g 

Deep sequencing

55 reads, 13 experiments

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296 ) and mir-219-2 on chromosome 9 (MI0000740 ) [2].

Genome context

• Coordinates (GRCh37.p5): chr9: 131154897-131154993 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-219-2

• hsa-mir-2964a: chr9: 131154900-131154987 [+]
• hsa-mir-219-2: chr9: 131154897-131154993 [-]

Database links

• EMBL: AJ550423;HSA550423
• ENTREZGENE: 407003;MIR219-2
• HGNC: 31598;MIR219-2

Mature sequence hsa-miR-219-5p

• Accession: MIMAT0000276
• Previous IDs: hsa-miR-219
• Sequence: 19 - ugauuguccaaacgcaauucu - 39
• Deep sequencing: 102 reads, 13 experiments
• Evidence: experimental; cloned [3]
• Validated targets:
  • MIRTARBASE:hsa-miR-219-5p
  • TARBASE:hsa-miR-219-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-219-5p
  • MICRORNA.ORG:hsa-miR-219-5p
  • MIRDB:hsa-miR-219-5p
  • RNA22-HSA:hsa-miR-219-5p
  • TARGETMINER:hsa-miR-219-5p
  • TARGETSCAN-VERT:hsa-miR-219-5p
  • PICTAR-VERT:hsa-miR-219

Mature sequence hsa-miR-219-2-3p

• Accession: MIMAT0004675
• Sequence: 62 - agaauuguggcuggacaucugu - 83
• Deep sequencing: 4 reads, 1 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-219-2-3p
  • MICRORNA.ORG:hsa-miR-219-2-3p
  • MIRDB:hsa-miR-219-2-3p
  • RNA22-HSA:hsa-miR-219-2-3p
  • TARGETMINER:hsa-miR-219-2-3p
  • TARGETSCAN-VERT:hsa-miR-219-2-3p
  • PICTAR-VERT:hsa-miR-219

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).