Stem-loop sequence hsa-mir-219a-2

AccessionMI0000740 (change log)
Symbol HGNC:MIR219A2
DescriptionHomo sapiens miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Literature search

70 open access papers mention hsa-mir-219a-2
(247 sentences)

Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
200519 reads, 142 reads per million, 118 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296) and mir-219-2 on chromosome 9 (MI0000740) [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 128392618-128392714 [-]
sense
OTTHUMT00000054088 ; MAPKAP1-005; intron 1
OTTHUMT00000355310 ; MAPKAP1-017; intron 1
OTTHUMT00000054096 ; MAPKAP1-013; intron 2
OTTHUMT00000355307 ; MAPKAP1-014; intron 2
OTTHUMT00000054094 ; MAPKAP1-011; intron 2
OTTHUMT00000054092 ; MAPKAP1-009; intron 3
OTTHUMT00000054091 ; MAPKAP1-008; intron 3
OTTHUMT00000355308 ; MAPKAP1-015; intron 4
OTTHUMT00000054090 ; MAPKAP1-007; intron 4
OTTHUMT00000054086 ; MAPKAP1-003; intron 4
ENST00000420643 ; MAPKAP1-005; intron 1
ENST00000473837 ; MAPKAP1-017; intron 1
ENST00000373497 ; MAPKAP1-202; intron 1
ENST00000427078 ; MAPKAP1-013; intron 2
ENST00000468896 ; MAPKAP1-014; intron 2
ENST00000448439 ; MAPKAP1-011; intron 2
ENST00000394063 ; MAPKAP1-203; intron 2
ENST00000373498 ; MAPKAP1-009; intron 3
ENST00000373503 ; MAPKAP1-008; intron 3
ENST00000373511 ; MAPKAP1-015; intron 4
ENST00000350766 ; MAPKAP1-007; intron 4
ENST00000394060 ; MAPKAP1-003; intron 4
ENST00000265960 ; MAPKAP1-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-219a-2
hsa-mir-219bchr9: 128392621-128392708 [+]
hsa-mir-219a-2chr9: 128392618-128392714 [-]
Database links

Mature sequence hsa-miR-219a-5p

Accession MIMAT0000276
Previous IDshsa-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing3742 reads, 132 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-219a-2-3p

Accession MIMAT0004675
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing198509 reads, 18 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).