Stem-loop sequence hsa-mir-101-2

AccessionMI0000739
Symbol HGNC:MIR101-2
DescriptionHomo sapiens miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     c
     gu  u                    a -    aaagu 
Get sequence
Deep sequencing
224602 reads, 4.64e+03 reads per million, 80 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MI0000103) and 9 (MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 4850297-4850375 [+]
sense
OTTHUMT00000051588 ; RCL1-002; intron 4
OTTHUMT00000051592 ; RCL1-006; intron 4
OTTHUMT00000051589 ; RCL1-003; intron 7
OTTHUMT00000051587 ; RCL1-001; intron 8
ENST00000362195 ; MIR101-2-201; exon 1
ENST00000381730 ; RCL1-002; intron 4
ENST00000381728 ; RCL1-006; intron 4
ENST00000448872 ; RCL1-201; intron 4
ENST00000442869 ; RCL1-003; intron 7
ENST00000381750 ; RCL1-001; intron 8
Database links

Mature sequence hsa-miR-101-3p

Accession MIMAT0000099
Previous IDshsa-miR-101
Sequence

49 - 

uacaguacugugauaacugaa

 - 69

Get sequence
Deep sequencing5442 reads, 72 experiments
Evidence experimental; cloned [1-4]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).