Stem-loop sequence hsa-mir-302a

AccessionMI0000738
Previous IDshsa-mir-302
Symbol HGNC:MIR302A
DescriptionHomo sapiens miR-302a stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
      c    u         u           gaa 
5' cca cacu aaacgugga guacuugcuuu   a
   ||| |||| ||||||||| |||||||||||   c
3' ggu gugg uuuguaccu cgugaaugaag   u
      a    u         u           aaa 
Get sequence
Deep sequencing
17848 reads, 1.87e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 112648183-112648251 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-302a
hsa-mir-302bchr4: 112648485-112648557 [-]
hsa-mir-302cchr4: 112648363-112648430 [-]
hsa-mir-302achr4: 112648183-112648251 [-]
hsa-mir-302dchr4: 112648004-112648071 [-]
hsa-mir-367chr4: 112647874-112647941 [-]
Database links

Mature sequence hsa-miR-302a-5p

Accession MIMAT0000683
Previous IDshsa-miR-302a*
Sequence

6 - 

acuuaaacguggauguacuugcu

 - 28

Get sequence
Deep sequencing652 reads, 3 experiments
Evidence experimental; cloned [2,4], Northern [2]
Predicted targets

Mature sequence hsa-miR-302a-3p

Accession MIMAT0000684
Previous IDshsa-miR-302a
Sequence

44 - 

uaagugcuuccauguuuugguga

 - 66

Get sequence
Deep sequencing4043 reads, 4 experiments
Evidence experimental; cloned [2,4], Northern [2]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).