Stem-loop sequence hsa-mir-302a

Accession

MI0000738

Previous IDs

hsa-mir-302

Symbol

HGNC:MIR302A

Description

Homo sapiens miR-302a stem-loop

Gene family

MIPF0000071; mir-302

Stem-loop

   c    u         u           gaa 
cca cacu aaacgugga guacuugcuuu   a
||| |||| ||||||||| |||||||||||   c
ggu gugg uuuguaccu cgugaaugaag   u
   a    u         u           aaa 

Deep sequencing

17676 reads, 4 experiments

Genome context

• Coordinates (GRCh37.p5): chr4: 113569339-113569407 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  antisense

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000363891 ; LARP7-002; intron 10

  OTTHUMT00000363891 ; LARP7-002; intron 10

  OTTHUMT00000363891 ; LARP7-002; intron 10

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000509061 ; LARP7-002; intron 10

  ENST00000509061 ; LARP7-002; intron 10

  ENST00000509061 ; LARP7-002; intron 10

Clustered miRNAs

< 10kb from hsa-mir-302a

• hsa-mir-302b: chr4: 113569641-113569713 [-]
• hsa-mir-302c: chr4: 113569519-113569586 [-]
• hsa-mir-302a: chr4: 113569339-113569407 [-]
• hsa-mir-302d: chr4: 113569160-113569227 [-]
• hsa-mir-367: chr4: 113569030-113569097 [-]

Database links

• ENTREZGENE: 407028;MIR302A
• HGNC: 31623;MIR302A

Mature sequence hsa-miR-302a-5p

• Accession: MIMAT0000683
• Previous IDs: hsa-miR-302a*
• Sequence: 6 - acuuaaacguggauguacuugcu - 28
• Deep sequencing: 730 reads, 2 experiments
• Evidence: experimental; cloned [2,4], Northern [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-302a-5p
  • MICRORNA.ORG:hsa-miR-302a-5p
  • MIRDB:hsa-miR-302a-5p
  • RNA22-HSA:hsa-miR-302a-5p
  • TARGETMINER:hsa-miR-302a-5p
  • PICTAR-VERT:hsa-miR-302a
  • PICTAR-VERT:hsa-miR-302a*

Mature sequence hsa-miR-302a-3p

• Accession: MIMAT0000684
• Previous IDs: hsa-miR-302a
• Sequence: 44 - uaagugcuuccauguuuugguga - 66
• Deep sequencing: 16946 reads, 4 experiments
• Evidence: experimental; cloned [2,4], Northern [2]
• Validated targets:
  • TARBASE:hsa-miR-302a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-302a-3p
  • MICRORNA.ORG:hsa-miR-302a-3p
  • MIRDB:hsa-miR-302a-3p
  • RNA22-HSA:hsa-miR-302a-3p
  • TARGETMINER:hsa-miR-302a-3p
  • TARGETSCAN-VERT:hsa-miR-302a
  • PICTAR-VERT:hsa-miR-302a
  • PICTAR-VERT:hsa-miR-302a*

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).