Stem-loop sequence hsa-mir-200a

AccessionMI0000737 (change log)
Symbol HGNC:MIR200A
DescriptionHomo sapiens miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

692 open access papers mention hsa-mir-200a
(3904 sentences)

Stem-loop
   c    - c   g        -            -----------     a 
5'  cggg c ccu ugagcauc uuaccggacagu           gcugg u
    |||| | ||| |||||||| ||||||||||||           ||||| u
3'  gccc g gga acuuguag aauggucuguca           cgacc u
   c    a u   a        c            caaucucaguu     c 
Get sequence
Deep sequencing
1216765 reads, 2.31e+03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1167863-1167952 [+]
sense
OTTHUMT00000005071 ; B3GALT6-001; 3'UTR (exon 1)
ENST00000379198 ; B3GALT6-001; 3'UTR (exon 1)
Clustered miRNAs
< 10kb from hsa-mir-200a
hsa-mir-200bchr1: 1167104-1167198 [+]
hsa-mir-200achr1: 1167863-1167952 [+]
hsa-mir-429chr1: 1169005-1169087 [+]
Database links

Mature sequence hsa-miR-200a-5p

Accession MIMAT0001620
Previous IDshsa-miR-200a*
Sequence

16 - 

caucuuaccggacagugcugga

 - 37

Get sequence
Deep sequencing16269 reads, 114 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-200a-3p

Accession MIMAT0000682
Previous IDshsa-miR-200a
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing1200448 reads, 153 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).