Stem-loop sequence MI0000736

Accession MI0000736
ID hsa-mir-30c-1
Symbol HGNC:MIR30C1
Description Homo sapiens miR-30c-1 stem-loop
Stem-loop
a     cu    ugu u       u   aca         ---g  a 
 ccaug  guag   g guaaaca ccu   cucucagcu    ug g
 |||||  ||||   | ||||||| |||   |||||||||    ||  
 gguac  cguc   c cauuugu ggg   gagggucgg    ac c
a     --    uuc u       u   --a         ugga  u 
Get sequence
Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MI0000736 ) and 6 (MI0000254 ) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2].

Genome context
Coordinates (GRCh37) Overlapping transcripts
1: 41222956-41223044 [+]
sense
OTTHUMT00000020810 ; NFYC-015; intron 1
OTTHUMT00000020811 ; NFYC-016; intron 1
OTTHUMT00000020802 ; NFYC-007; intron 4
OTTHUMT00000020796 ; NFYC-001; intron 5
OTTHUMT00000020797 ; NFYC-002; intron 5
OTTHUMT00000020799 ; NFYC-004; intron 5
OTTHUMT00000020801 ; NFYC-006; intron 5
OTTHUMT00000020806 ; NFYC-011; intron 5
OTTHUMT00000020807 ; NFYC-012; intron 5
OTTHUMT00000020808 ; NFYC-013; intron 5
OTTHUMT00000020800 ; NFYC-005; intron 6
OTTHUMT00000020798 ; NFYC-003; intron 10
ENST00000440226 ; NFYC-015; intron 1
ENST00000414185 ; NFYC-016; intron 1
ENST00000424419 ; NFYC-205; intron 2
ENST00000308733 ; NFYC-007; intron 4
ENST00000427410 ; NFYC-207; intron 4
ENST00000447388 ; NFYC-001; intron 5
ENST00000372655 ; NFYC-002; intron 5
ENST00000372652 ; NFYC-004; intron 5
ENST00000372651 ; NFYC-006; intron 5
ENST00000416859 ; NFYC-011; intron 5
ENST00000372669 ; NFYC-012; intron 5
ENST00000467203 ; NFYC-013; intron 5
ENST00000397229 ; NFYC-203; intron 5
ENST00000425457 ; NFYC-206; intron 5
ENST00000456393 ; NFYC-208; intron 5
ENST00000413180 ; NFYC-204; intron 5
ENST00000372657 ; NFYC-201; intron 5
ENST00000372658 ; NFYC-202; intron 5
ENST00000372654 ; NFYC-005; intron 6
ENST00000372653 ; NFYC-003; intron 10

View flanking features
Clustered miRNAs
< 10kb from hsa-mir-30c-1
hsa-mir-30e 1: 41220027-41220118 [+]
hsa-mir-30c-1 1: 41222956-41223044 [+]
Database links
Gene family

MIPF0000005; mir-30

Mature sequence MIMAT0000244

Accession MIMAT0000244
ID hsa-miR-30c
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Evidence experimental; cloned [2,4-6]
Predicted targets

Minor miR* sequence MIMAT0004674

Accession MIMAT0004674
ID hsa-miR-30c-1*
Sequence

56 - 

cugggagaggguuguuuacucc

 - 77

Get sequence
Evidence experimental; cloned [5]
Predicted targets

References

1
"Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
"Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
"Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).