Stem-loop sequence MI0000736

Accession

MI0000736

ID

hsa-mir-30c-1

Symbol

HGNC:MIR30C1

Description

Homo sapiens miR-30c-1 stem-loop

Stem-loop

a     cu    ugu u       u   aca         ---g  a 
 ccaug  guag   g guaaaca ccu   cucucagcu    ug g
 |||||  ||||   | ||||||| |||   |||||||||    ||  
 gguac  cguc   c cauuugu ggg   gagggucgg    ac c
a     --    uuc u       u   --a         ugga  u 

Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MI0000736 ) and 6 (MI0000254 ) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2].

Genome context

• Coordinates (GRCh37): 1: 41222956-41223044 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000020810 ; NFYC-015; intron 1

  OTTHUMT00000020811 ; NFYC-016; intron 1

  OTTHUMT00000020802 ; NFYC-007; intron 4

  OTTHUMT00000020796 ; NFYC-001; intron 5

  OTTHUMT00000020797 ; NFYC-002; intron 5

  OTTHUMT00000020799 ; NFYC-004; intron 5

  OTTHUMT00000020801 ; NFYC-006; intron 5

  OTTHUMT00000020806 ; NFYC-011; intron 5

  OTTHUMT00000020807 ; NFYC-012; intron 5

  OTTHUMT00000020808 ; NFYC-013; intron 5

  OTTHUMT00000020800 ; NFYC-005; intron 6

  OTTHUMT00000020798 ; NFYC-003; intron 10

  ENST00000440226 ; NFYC-015; intron 1

  ENST00000414185 ; NFYC-016; intron 1

  ENST00000424419 ; NFYC-205; intron 2

  ENST00000427410 ; NFYC-207; intron 4

  ENST00000308733 ; NFYC-007; intron 4

  ENST00000397229 ; NFYC-203; intron 5

  ENST00000425457 ; NFYC-206; intron 5

  ENST00000447388 ; NFYC-001; intron 5

  ENST00000456393 ; NFYC-208; intron 5

  ENST00000413180 ; NFYC-204; intron 5

  ENST00000372658 ; NFYC-202; intron 5

  ENST00000372657 ; NFYC-201; intron 5

  ENST00000372655 ; NFYC-002; intron 5

  ENST00000372669 ; NFYC-012; intron 5

  ENST00000372652 ; NFYC-004; intron 5

  ENST00000372651 ; NFYC-006; intron 5

  ENST00000416859 ; NFYC-011; intron 5

  ENST00000372654 ; NFYC-005; intron 6

  ENST00000372653 ; NFYC-003; intron 10

View flanking features

Clustered miRNAs

< 10kb from hsa-mir-30c-1

• hsa-mir-30e: 1: 41220027-41220118 [+]
• hsa-mir-30c-1: 1: 41222956-41223044 [+]

Database links

• HGNC: 31626;MIR30C1
• ENTREZGENE: 407031;MIR30C1

Gene family

MIPF0000005; mir-30

Mature sequence MIMAT0000244

• Accession: MIMAT0000244
• ID: hsa-miR-30c
• Sequence: 17 - uguaaacauccuacacucucagc - 39
• Evidence: experimental; cloned [2,4-6]
• Predicted targets:
  • MICROCOSM:hsa-miR-30c
  • TARGETSCAN:hsa-miR-30c
  • PICTAR-VERT:hsa-miR-30c

Minor miR* sequence MIMAT0004674

• Accession: MIMAT0004674
• ID: hsa-miR-30c-1*
• Sequence: 56 - cugggagaggguuguuuacucc - 77
• Evidence: experimental; cloned [5]
• Predicted targets:
  • MICROCOSM:hsa-miR-30c-1*
  • TARGETSCAN:hsa-miR-30c-1*

References

1. "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).