Stem-loop sequence hsa-mir-29c

AccessionMI0000735 (change log)
Symbol HGNC:MIR29C
DescriptionHomo sapiens miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

512 open access papers mention hsa-mir-29c
(2592 sentences)

Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
4280347 reads, 1.12e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 207801852-207801939 [-]
antisense
OTTHUMT00000382528 ; CR1-011; intron 13
OTTHUMT00000382524 ; CR1-007; intron 37
OTTHUMT00000088499 ; CR1-002; intron 37
OTTHUMT00000088500 ; CR1-003; intron 37
OTTHUMT00000088335 ; CR1-001; intron 37
OTTHUMT00000382527 ; CR1-012; intron 45
ENST00000529814 ; CR1-011; intron 13
ENST00000367052 ; CR1-007; intron 37
ENST00000367051 ; CR1-002; intron 37
ENST00000367053 ; CR1-003; intron 37
ENST00000400960 ; CR1-001; intron 37
ENST00000367049 ; CR1-012; intron 45
Clustered miRNAs
< 10kb from hsa-mir-29c
hsa-mir-29b-2chr1: 207802443-207802523 [-]
hsa-mir-29cchr1: 207801852-207801939 [-]
Database links

Mature sequence hsa-miR-29c-5p

Accession MIMAT0004673
Previous IDshsa-miR-29c*
Sequence

16 - 

ugaccgauuucuccugguguuc

 - 37

Get sequence
Deep sequencing45474 reads, 152 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-29c-3p

Accession MIMAT0000681
Previous IDshsa-miR-29c
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing4234837 reads, 159 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).