![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-29c |
||||||
Accession | MI0000735 (change log) | |||||
Symbol | HGNC:MIR29C | |||||
Description | Homo sapiens miR-29c stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Literature search |
![]()
512 open access papers mention hsa-mir-29c | |||||
Stem-loop |
a - ggc ucc --- u 5' ucucuuaca ca ugaccgauuuc ugguguu cagag c ||||||||| || ||||||||||| ||||||| ||||| u 3' gggggaugu gu auuggcuaaag accacga guuuu g a a --- uuu ucu u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-29c-5p |
|
Accession | MIMAT0004673 |
Previous IDs | hsa-miR-29c* |
Sequence |
16 - ugaccgauuucuccugguguuc - 37 |
Deep sequencing | 45474 reads, 152 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-29c-3p |
|
Accession | MIMAT0000681 |
Previous IDs | hsa-miR-29c |
Sequence |
54 - uagcaccauuugaaaucgguua - 75 |
Deep sequencing | 4234837 reads, 159 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|