Stem-loop sequence hsa-mir-29c

Accession

MI0000735

Symbol

HGNC:MIR29C

Description

Homo sapiens miR-29c stem-loop

Gene family

MIPF0000009; mir-29

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Stem-loop

   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 

Deep sequencing

109244 reads, 8.57e+03 reads per million, 77 experiments

Confidence

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38): chr1: 207801852-207801939 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000382528 ; CR1-011; intron 13

  OTTHUMT00000382524 ; CR1-007; intron 37

  OTTHUMT00000088499 ; CR1-002; intron 37

  OTTHUMT00000088500 ; CR1-003; intron 37

  OTTHUMT00000088335 ; CR1-001; intron 37

  OTTHUMT00000382527 ; CR1-012; intron 45

  ENST00000529814 ; CR1-011; intron 13

  ENST00000367052 ; CR1-007; intron 37

  ENST00000367051 ; CR1-002; intron 37

  ENST00000367053 ; CR1-003; intron 37

  ENST00000400960 ; CR1-001; intron 37

  ENST00000367049 ; CR1-012; intron 45

Clustered miRNAs

< 10kb from hsa-mir-29c

• hsa-mir-29b-2: chr1: 207802443-207802523 [-]
• hsa-mir-29c: chr1: 207801852-207801939 [-]

Database links

• MIRBASE-TRACKER:MI0000735
• ENTREZGENE: 407026;MIR29C
• HGNC: 31621;MIR29C

Mature sequence hsa-miR-29c-5p

• Accession: MIMAT0004673
• Previous IDs: hsa-miR-29c*
• Sequence: 16 - ugaccgauuucuccugguguuc - 37
• Deep sequencing: 1427 reads, 55 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-29c-5p
  • MICRORNA.ORG:hsa-miR-29c-5p
  • MIRDB:hsa-miR-29c-5p
  • RNA22-HSA:hsa-miR-29c-5p
  • TARGETMINER:hsa-miR-29c-5p
  • PICTAR-VERT:hsa-miR-29c

Mature sequence hsa-miR-29c-3p

• Accession: MIMAT0000681
• Previous IDs: hsa-miR-29c
• Sequence: 54 - uagcaccauuugaaaucgguua - 75
• Deep sequencing: 824 reads, 52 experiments
• Evidence: experimental; cloned [2-4]
• Validated targets:
  • MIRTARBASE:hsa-miR-29c-3p
  • TARBASE:hsa-miR-29c-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-29c-3p
  • MICRORNA.ORG:hsa-miR-29c-3p
  • MIRDB:hsa-miR-29c-3p
  • RNA22-HSA:hsa-miR-29c-3p
  • TARGETMINER:hsa-miR-29c-3p
  • TARGETSCAN-VERT:hsa-miR-29c

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).