Stem-loop sequence hsa-mir-106b

AccessionMI0000734 (change log)
Symbol HGNC:MIR106B
DescriptionHomo sapiens miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

290 open access papers mention hsa-mir-106b
(1676 sentences)

Stem-loop
        c     -ua       g       a a    --  uc 
5' ccugc ggggc   aagugcu acagugc g uagu  gg  c
   ||||| |||||   ||||||| ||||||| | ||||  ||   
3' ggacg ccucg   uucaugg ugucacg c aucg  cc  u
        a     ucg       g       c -    ug  uc 
Get sequence
Deep sequencing
653259 reads, 1.84e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 100093993-100094074 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-106b
hsa-mir-106bchr7: 100093993-100094074 [-]
hsa-mir-93chr7: 100093768-100093847 [-]
hsa-mir-25chr7: 100093560-100093643 [-]
Database links

Mature sequence hsa-miR-106b-5p

Accession MIMAT0000680
Previous IDshsa-miR-106b
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing620320 reads, 158 experiments
Evidence experimental; cloned [3-6]
Database links
Predicted targets

Mature sequence hsa-miR-106b-3p

Accession MIMAT0004672
Previous IDshsa-miR-106b*
Sequence

52 - 

ccgcacuguggguacuugcugc

 - 73

Get sequence
Deep sequencing32925 reads, 159 experiments
Evidence experimental; cloned [5-7], Northern [7]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).