Stem-loop sequence hsa-mir-106b

Accession MI0000734
Symbol HGNC:MIR106B
Description Homo sapiens miR-106b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     c     -ua       g       a a    --  uc 
ccugc ggggc   aagugcu acagugc g uagu  gg  c
||||| |||||   ||||||| ||||||| | ||||  ||   
ggacg ccucg   uucaugg ugucacg c aucg  cc  u
     a     ucg       g       c -    ug  uc 
Get sequence
Deep sequencing
20692 reads, 37 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 99691616-99691697 [-]
sense
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336534 ; MCM7-001; intron 13
OTTHUMT00000336534 ; MCM7-001; intron 13
OTTHUMT00000336534 ; MCM7-001; intron 13
ENST00000493352 ; MCM7-014; intron 2
ENST00000493352 ; MCM7-014; intron 2
ENST00000493352 ; MCM7-014; intron 2
ENST00000491245 ; MCM7-005; intron 4
ENST00000491245 ; MCM7-005; intron 4
ENST00000491245 ; MCM7-005; intron 4
ENST00000343023 ; MCM7-003; intron 8
ENST00000343023 ; MCM7-003; intron 8
ENST00000343023 ; MCM7-003; intron 8
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000542483 ; MCM7-203; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000542483 ; MCM7-203; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000303887 ; MCM7-001; intron 13
ENST00000303887 ; MCM7-001; intron 13
ENST00000303887 ; MCM7-001; intron 13
ENST00000362082 ; MCM7-202; intron 14
ENST00000362082 ; MCM7-202; intron 14
Clustered miRNAs
< 10kb from hsa-mir-106b
hsa-mir-106b chr7: 99691616-99691697 [-]
hsa-mir-93 chr7: 99691391-99691470 [-]
hsa-mir-25 chr7: 99691183-99691266 [-]
Database links

Mature sequence hsa-miR-106b-5p

Accession MIMAT0000680
Previous IDs hsa-miR-106b
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing 17855 reads, 35 experiments
Evidence experimental; cloned [3-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-106b-3p

Accession MIMAT0004672
Previous IDs hsa-miR-106b*
Sequence

52 - 

ccgcacuguggguacuugcugc

 - 73

Get sequence
Deep sequencing 2837 reads, 22 experiments
Evidence experimental; cloned [5-7], Northern [7]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).