![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-217 |
||||||
Accession | MI0000731 (change log) | |||||
Symbol | MGI:Mir217 | |||||
Description | Mus musculus miR-217 stem-loop | |||||
Gene family | MIPF0000077; mir-217 | |||||
Stem-loop |
aaacauagucauuaca uu c a c c -cu aag 5' guuu gauguug ag ua ugcau aggaacuga ggau a |||| ||||||| || || ||||| ||||||||| |||| 3' caaa cuacgac uc gu acgua uccuugacu ccua c --------------aa -u u c u a acc auu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-217-5p |
|
Accession | MIMAT0000679 |
Previous IDs | mmu-miR-217 |
Sequence |
34 - uacugcaucaggaacugacugga - 56 |
Deep sequencing | 58553 reads, 39 experiments |
Evidence | experimental; cloned [3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-217-3p |
|
Accession | MIMAT0017072 |
Previous IDs | mmu-miR-217* |
Sequence |
71 - caucaguuccuaaugcauugccu - 93 |
Deep sequencing | 188 reads, 9 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|