Stem-loop sequence mmu-mir-7b

AccessionMI0000730 (change log)
Symbol MGI:Mir7b
DescriptionMus musculus miR-7b stem-loop
Gene family MIPF0000022; mir-7
Literature search

114 open access papers mention mmu-mir-7b
(977 sentences)

Stem-loop
   aggagcggaguacgu   -   g       u  aagac         u      c  au 
5'                gag cca ugcuaug gg     uugugauuu guuguu ug  a
                  ||| ||| ||||||| ||     ||||||||| |||||| ||   
3'                cuc ggu gcgauac cc     gacacugaa caacag au  u
   -----uuccacuauc   a   -       u  -gacc         -      u  ag 
Get sequence
Deep sequencing
170965 reads, 810 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MI0000728) and mir-7-2 (MI0000729) in mouse, and mir-7-1 (MI0000263), mir-7-2 (MI0000264) and mir-7-3 (MI0000265) in human.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 56242988-56243098 [+]
intergenic
Database links

Mature sequence mmu-miR-7b-5p

Accession MIMAT0000678
Previous IDsmmu-miR-7b
Sequence

30 - 

uggaagacuugugauuuuguuguu

 - 53

Get sequence
Deep sequencing170715 reads, 105 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-7b-3p

Accession MIMAT0017071
Previous IDsmmu-miR-7b*
Sequence

68 - 

caacaagucacagccagccuca

 - 89

Get sequence
Deep sequencing238 reads, 13 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).