Stem-loop sequence mmu-mir-7a-2

AccessionMI0000729 (change log)
Previous IDsmmu-mir-7-2
DescriptionMus musculus miR-7a-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

135 open access papers mention mmu-mir-7a-2
(1246 sentences)

Stem-loop
   -  ucg       c    u   a     a u     u       ug cu 
5'  gg   ggccagc ccgu ugg agacu g gauuu guuguug  u  c
    ||   ||||||| |||| ||| ||||| | ||||| |||||||  |   
3'  cu   cuggucg ggua acc ucuga c cugaa caacaac  a  u
   a  uua       u    c   g     c -     -       cu ug 
Get sequence
Deep sequencing
197947 reads, 851 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 78888277-78888373 [+]
intergenic
Database links

Mature sequence mmu-miR-7a-5p

Accession MIMAT0000677
Previous IDsmmu-miR-7;mmu-miR-7a
Sequence

19 - 

uggaagacuagugauuuuguugu

 - 41

Get sequence
Deep sequencing393949 reads, 107 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-7a-2-3p

Accession MIMAT0017070
Previous IDsmmu-miR-7a-2*
Sequence

59 - 

caacaagucccagucugccaca

 - 80

Get sequence
Deep sequencing1181 reads, 47 experiments
Evidence experimental; Illumina [6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).