Stem-loop sequence mmu-mir-7a-1

AccessionMI0000728 (change log)
Previous IDsmmu-mir-7-1
Symbol MGI:Mir7-1
DescriptionMus musculus miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

135 open access papers mention mmu-mir-7a-1
(1248 sentences)

Stem-loop
   --u    u  u     a  u        a     a       u      --     a 
5'    ugga gu ggccu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||| || ||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    aucu ca ccgga ca gguauacc ucuga cacuaaa caacag  aaauc a
   gac    c  -     -  c        g     -       -      ca     a 
Get sequence
Deep sequencing
205117 reads, 881 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 58392779-58392886 [-]
sense
OTTMUST00000110442 ; Hnrnpk-018; intron 2
OTTMUST00000110444 ; Hnrnpk-019; intron 3
OTTMUST00000110443 ; Hnrnpk-020; intron 5
OTTMUST00000110445 ; Hnrnpk-021; intron 7
OTTMUST00000110425 ; Hnrnpk-004; intron 11
OTTMUST00000110426 ; Hnrnpk-009; intron 14
OTTMUST00000110427 ; Hnrnpk-008; intron 14
OTTMUST00000092043 ; Hnrnpk-002; intron 15
OTTMUST00000092042 ; Hnrnpk-001; intron 17
ENSMUST00000177051 ; Hnrnpk-018; intron 2
ENSMUST00000176359 ; Hnrnpk-019; intron 3
ENSMUST00000176257 ; Hnrnpk-020; intron 5
ENSMUST00000176797 ; Hnrnpk-021; intron 7
ENSMUST00000177497 ; Hnrnpk-004; intron 11
ENSMUST00000177019 ; Hnrnpk-009; intron 14
ENSMUST00000176207 ; Hnrnpk-008; intron 14
ENSMUST00000043269 ; Hnrnpk-002; intron 15
ENSMUST00000116403 ; Hnrnpk-001; intron 17
Database links

Mature sequence mmu-miR-7a-5p

Accession MIMAT0000677
Previous IDsmmu-miR-7;mmu-miR-7a
Sequence

24 - 

uggaagacuagugauuuuguugu

 - 46

Get sequence
Deep sequencing393949 reads, 107 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-7a-1-3p

Accession MIMAT0004670
Previous IDsmmu-miR-7a*;mmu-miR-7a-1*
Sequence

66 - 

caacaaaucacagucugccaua

 - 87

Get sequence
Deep sequencing7629 reads, 104 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).