Stem-loop sequence mmu-mir-7a-1

Accession MI0000728
Previous IDs mmu-mir-7-1
Symbol MGI:Mirn7-1
Description Mus musculus miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--u    u  u     a  u        a     a       u      --     a 
   ugga gu ggccu gu cugugugg agacu gugauuu guuguu  uuuag u
   |||| || ||||| || |||||||| ||||| ||||||| ||||||  |||||  
   aucu ca ccgga ca gguauacc ucuga cacuaaa caacag  aaauc a
gac    c  -     -  c        g     -       -      ca     a 
Get sequence
Deep sequencing
1177147 reads, 96 experiments
Comments

miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr13: 58392779-58392886 [-]
sense
OTTMUST00000110442 ; Hnrnpk-018; intron 2
OTTMUST00000110444 ; Hnrnpk-019; intron 3
OTTMUST00000110443 ; Hnrnpk-020; intron 5
OTTMUST00000110445 ; Hnrnpk-021; intron 7
OTTMUST00000110425 ; Hnrnpk-004; intron 11
OTTMUST00000110427 ; Hnrnpk-008; intron 14
OTTMUST00000110426 ; Hnrnpk-009; intron 14
OTTMUST00000092043 ; Hnrnpk-002; intron 15
OTTMUST00000092042 ; Hnrnpk-001; intron 17
ENSMUST00000177051 ; Hnrnpk-018; intron 2
ENSMUST00000176359 ; Hnrnpk-019; intron 3
ENSMUST00000176257 ; Hnrnpk-020; intron 5
ENSMUST00000176797 ; Hnrnpk-021; intron 7
ENSMUST00000177497 ; Hnrnpk-004; intron 11
ENSMUST00000176207 ; Hnrnpk-008; intron 14
ENSMUST00000177019 ; Hnrnpk-009; intron 14
ENSMUST00000043269 ; Hnrnpk-002; intron 15
ENSMUST00000116403 ; Hnrnpk-001; intron 17
Database links

Mature sequence mmu-miR-7a-5p

Accession MIMAT0000677
Previous IDs mmu-miR-7;mmu-miR-7a
Sequence

24 - 

uggaagacuagugauuuuguugu

 - 46

Get sequence
Deep sequencing 356951 reads, 81 experiments
Evidence experimental; cloned [2,4], Solexa [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-7a-1-3p

Accession MIMAT0004670
Previous IDs mmu-miR-7a*;mmu-miR-7a-1*
Sequence

66 - 

caacaaaucacagucugccaua

 - 87

Get sequence
Deep sequencing 6353 reads, 78 experiments
Evidence experimental; cloned [4], Solexa [5-6]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).