Stem-loop sequence hsa-mir-128-2

AccessionMI0000727
Previous IDshsa-mir-128b
Symbol HGNC:MIR128-2
DescriptionHomo sapiens miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ug       a          aua      ac    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Deep sequencing
51592 reads, 3.98e+03 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 35744476-35744559 [+]
sense
OTTHUMT00000341656 ; ARPP21-035; intron 1
OTTHUMT00000341651 ; ARPP21-030; intron 2
OTTHUMT00000341652 ; ARPP21-031; intron 2
OTTHUMT00000341650 ; ARPP21-029; intron 3
OTTHUMT00000341613 ; ARPP21-006; intron 8
OTTHUMT00000341609 ; ARPP21-002; intron 9
OTTHUMT00000253334 ; ARPP21-001; intron 9
ENST00000476327 ; ARPP21-035; intron 1
ENST00000425289 ; ARPP21-030; intron 2
ENST00000427590 ; ARPP21-031; intron 2
ENST00000446068 ; ARPP21-029; intron 3
ENST00000417925 ; ARPP21-006; intron 8
ENST00000444190 ; ARPP21-002; intron 9
ENST00000187397 ; ARPP21-001; intron 9
ENST00000458225 ; ARPP21-202; intron 9
ENST00000337271 ; ARPP21-201; intron 9
Database links

Mature sequence hsa-miR-128-2-5p

Accession MIMAT0031095
Sequence

15 - 

gggggccgauacacuguacgaga

 - 37

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence hsa-miR-128-3p

Accession MIMAT0000424
Previous IDshsa-miR-128a
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing78733 reads, 65 experiments
Evidence experimental; cloned [3], Illumina [4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).