Stem-loop sequence hsa-mir-128-2

Accession MI0000727
Previous IDs hsa-mir-128b
Symbol HGNC:MIR128-2
Description Homo sapiens miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop 
u ug       a          aua      ac    g gag 
 g  caguggg aggggggccg   cacugu  gaga u   u
 |  ||||||| ||||||||||   ||||||  |||| |    
 u  gucaucc uuucucuggc   gugaca  cucu g   a
c gu       c          caa      --    g acg
Get sequence
Deep sequencing
25133 reads, 25 experiments
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 35785968-35786051 [+]
sense
OTTHUMT00000341657 ; AC104308.1-036; intron 3
OTTHUMT00000341657 ; AC104308.1-036; intron 3
OTTHUMT00000341657 ; AC104308.1-036; intron 3
OTTHUMT00000341618 ; AC104308.1-011; intron 6
OTTHUMT00000341618 ; AC104308.1-011; intron 6
OTTHUMT00000341618 ; AC104308.1-011; intron 6
OTTHUMT00000341609 ; AC104308.1-002; intron 17
OTTHUMT00000341613 ; AC104308.1-006; intron 17
OTTHUMT00000341609 ; AC104308.1-002; intron 17
OTTHUMT00000341613 ; AC104308.1-006; intron 17
OTTHUMT00000341609 ; AC104308.1-002; intron 17
OTTHUMT00000341613 ; AC104308.1-006; intron 17
OTTHUMT00000253334 ; AC104308.1-001; intron 18
OTTHUMT00000253334 ; AC104308.1-001; intron 18
OTTHUMT00000253334 ; AC104308.1-001; intron 18
ENST00000462173 ; ARPP21-036; intron 3
ENST00000462173 ; ARPP21-036; intron 3
ENST00000462173 ; ARPP21-036; intron 3
ENST00000457165 ; ARPP21-011; intron 6
ENST00000457165 ; ARPP21-011; intron 6
ENST00000457165 ; ARPP21-011; intron 6
ENST00000444190 ; ARPP21-002; intron 17
ENST00000417925 ; ARPP21-006; intron 17
ENST00000337271 ; ARPP21-201; intron 17
ENST00000444190 ; ARPP21-002; intron 17
ENST00000417925 ; ARPP21-006; intron 17
ENST00000337271 ; ARPP21-201; intron 17
ENST00000444190 ; ARPP21-002; intron 17
ENST00000417925 ; ARPP21-006; intron 17
ENST00000337271 ; ARPP21-201; intron 17
ENST00000187397 ; ARPP21-001; intron 18
ENST00000458225 ; ARPP21-202; intron 18
ENST00000187397 ; ARPP21-001; intron 18
ENST00000458225 ; ARPP21-202; intron 18
ENST00000187397 ; ARPP21-001; intron 18
ENST00000458225 ; ARPP21-202; intron 18
Database links

Mature sequence hsa-miR-128

Accession MIMAT0000424
Previous IDs hsa-miR-128a
Sequence

52 -  

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing 50409 reads, 30 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).