Stem-loop sequence mmu-mir-128-2

AccessionMI0000726
Previous IDsmmu-mir-128b
Symbol MGI:Mir128-2
DescriptionMus musculus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
          a          aug      aa    g gag 
5' caguggg aggggggccg   cacugu  gaga u   u
   ||||||| ||||||||||   ||||||  |||| |    
3' gucaucc uuucucuggc   gugaca  cucu g   a
          c          caa      --    g acg 
Get sequence
Deep sequencing
770620 reads, 2.14e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 112118636-112118711 [-]
sense
OTTMUST00000088278 ; Arpp21-007; intron 14
OTTMUST00000088286 ; Arpp21-015; intron 15
OTTMUST00000088284 ; Arpp21-013; intron 15
OTTMUST00000088285 ; Arpp21-014; intron 16
OTTMUST00000088274 ; Arpp21-003; intron 16
OTTMUST00000088276 ; Arpp21-005; intron 17
OTTMUST00000088272 ; Arpp21-001; intron 19
ENSMUST00000083507 ; Mir128-2-201; exon 1
ENSMUST00000159451 ; Arpp21-007; intron 14
ENSMUST00000160240 ; Arpp21-015; intron 15
ENSMUST00000159246 ; Arpp21-013; intron 15
ENSMUST00000162065 ; Arpp21-014; intron 16
ENSMUST00000159432 ; Arpp21-003; intron 16
ENSMUST00000035085 ; Arpp21-005; intron 17
ENSMUST00000111872 ; Arpp21-202; intron 17
ENSMUST00000164754 ; Arpp21-203; intron 17
ENSMUST00000070218 ; Arpp21-201; intron 17
ENSMUST00000162097 ; Arpp21-001; intron 19
Database links

Mature sequence mmu-miR-128-2-5p

Accession MIMAT0017069
Previous IDsmmu-miR-128-2*
Sequence

11 - 

gggggccgaugcacuguaagaga

 - 33

Get sequence
Deep sequencing401 reads, 28 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-128-3p

Accession MIMAT0000140
Previous IDsmmu-miR-128a;mmu-miR-128
Sequence

48 - 

ucacagugaaccggucucuuu

 - 68

Get sequence
Deep sequencing1027768 reads, 88 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).