Stem-loop sequence mmu-mir-125b-1

AccessionMI0000725 (change log)
Symbol MGI:Mir125b-1
DescriptionMus musculus miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ugcgcuccccu   uc  ug   c           au     c 
5'            cag  cc  aga ccuaacuugug  guuua c
              |||  ||  ||| |||||||||||  ||||| g
3'            guc  gg  ucu ggauugggcac  uaaau u
   -----------   ga  gu   c           -c     u 
Get sequence
Deep sequencing
446596 reads, 4.74e+03 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 41581926-41582002 [+]
sense
OTTMUST00000112036 ; RP23-442M18.1-002; intron 1
OTTMUST00000112037 ; RP23-442M18.1-003; intron 1
OTTMUST00000112038 ; RP23-442M18.1-004; intron 1
OTTMUST00000112039 ; RP23-442M18.1-001; intron 1
ENSMUST00000181214 ; 2610203C20Rik-002; intron 1
ENSMUST00000180622 ; 2610203C20Rik-003; intron 1
ENSMUST00000180818 ; 2610203C20Rik-004; intron 1
ENSMUST00000181955 ; 2610203C20Rik-001; intron 1
ENSMUST00000098868 ; 2610203C20Rik-201; intron 2
Database links

Mature sequence mmu-miR-125b-5p

Accession MIMAT0000136
Previous IDsmmu-miR-125b
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing879229 reads, 75 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-125b-1-3p

Accession MIMAT0004669
Previous IDsmmu-miR-125b-3p
Sequence

55 - 

acggguuaggcucuugggagcu

 - 76

Get sequence
Deep sequencing6867 reads, 50 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).