Stem-loop sequence mmu-mir-125b-1

Accession MI0000725
Symbol MGI:Mir125b-1
Description Mus musculus miR-125b-1 stem-loop
Gene family MIPF0000017; mir-125
Stem-loop 
ugcgcuccccu   uc  ug   c           au     c 
           cag  cc  aga ccuaacuugug  guuua c
           |||  ||  ||| |||||||||||  ||||| g
           guc  gg  ucu ggauugggcac  uaaau u
-----------   ga  gu   c           -c     u
Get sequence
Deep sequencing
579316 reads, 96 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 41581926-41582002 [+]
sense
ENSMUST00000098868 ; 2610203C20Rik-201; intron 2
Database links

Mature sequence mmu-miR-125b-5p

Accession MIMAT0000136
Previous IDs mmu-miR-125b
Sequence

15 -  

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing 1120026 reads, 80 experiments
Evidence experimental; cloned [1,3-4], Solexa [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-125b-1-3p

Accession MIMAT0004669
Previous IDs mmu-miR-125b-3p
Sequence

55 -  

acggguuaggcucuugggagcu

 - 76

Get sequence
Deep sequencing 8501 reads, 57 experiments
Evidence experimental; cloned [4], Solexa [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).