Stem-loop sequence mmu-mir-181c

AccessionMI0000724 (change log)
Symbol MGI:Mir181c
DescriptionMus musculus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

134 open access papers mention mmu-mir-181c
(662 sentences)

Stem-loop
   g   a  g       gaa        cu       a     ggca 
5'  cca gg uuugggg   cauucaac  gucggug guuug    g
    ||| || |||||||   ||||||||  ||||||| |||||    c
3'  ggu cc gagcccc   gugaguug  cagcuac caaac    u
   a   -  g       -ag        -c       -     agac 
Get sequence
Deep sequencing
463958 reads, 592 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-181c was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish and independently in mouse [2,3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 84178873-84178961 [-]
sense
ENSMUST00000083549 ; Mir181c-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-181c
mmu-mir-181cchr8: 84178873-84178961 [-]
mmu-mir-181dchr8: 84178716-84178787 [-]
Database links

Mature sequence mmu-miR-181c-5p

Accession MIMAT0000674
Previous IDsmmu-miR-181c
Sequence

17 - 

aacauucaaccugucggugagu

 - 38

Get sequence
Deep sequencing381510 reads, 105 experiments
Evidence experimental; cloned [2-3], Illumina [4,6]
Database links
Predicted targets

Mature sequence mmu-miR-181c-3p

Accession MIMAT0017068
Previous IDsmmu-miR-181c*
Sequence

56 - 

accaucgaccguugaguggacc

 - 77

Get sequence
Deep sequencing82446 reads, 104 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).