Stem-loop sequence mmu-mir-181b-1

AccessionMI0000723 (change log)
Previous IDsmmu-mir-181b
Symbol MGI:Mir181b-1
DescriptionMus musculus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

165 open access papers mention mmu-mir-181b-1
(1244 sentences)

Stem-loop
   a       aucaa         cug          gaa  g 
5'  ggucaca     cauucauug   ucgguggguu   cu u
    |||||||     |||||||||   ||||||||||   ||  
3'  ccggugu     guaaguaac   agucacucga   ga g
   -       -caac         --a          aaa  u 
Get sequence
Deep sequencing
1502039 reads, 2.43e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 137966639-137966718 [+]
sense
OTTMUST00000113293 ; RP23-44N5.6-001; exon 1
OTTMUST00000113282 ; RP23-393I12.2-001; intron 2
ENSMUST00000182158 ; A430106G13Rik-001; exon 1
ENSMUST00000182127 ; Gm4258-001; intron 2
antisense
OTTMUST00000113287 ; RP23-44N5.2-001; intron 1
OTTMUST00000113288 ; RP23-44N5.2-002; intron 1
ENSMUST00000182424 ; Gm26936-001; intron 1
ENSMUST00000182680 ; Gm26936-002; intron 1
Clustered miRNAs
< 10kb from mmu-mir-181b-1
mmu-mir-181a-1chr1: 137966455-137966541 [+]
mmu-mir-181b-1chr1: 137966639-137966718 [+]
Database links

Mature sequence mmu-miR-181b-5p

Accession MIMAT0000673
Previous IDsmmu-miR-181b
Sequence

12 - 

aacauucauugcugucgguggguu

 - 35

Get sequence
Deep sequencing3015553 reads, 107 experiments
Evidence experimental; cloned [2-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-181b-1-3p

Accession MIMAT0017067
Previous IDsmmu-miR-181b-1*
Sequence

52 - 

cucacugaacaaugaaugcaa

 - 72

Get sequence
Deep sequencing7114 reads, 91 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).