Stem-loop sequence mmu-mir-181b-1

Accession MI0000723
Previous IDs mmu-mir-181b
Symbol MGI:Mir181b-1
Description Mus musculus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a       aucaa         cug          gaa  g 
 ggucaca     cauucauug   ucgguggguu   cu u
 |||||||     |||||||||   ||||||||||   ||  
 ccggugu     guaaguaac   agucacucga   ga g
-       -caac         --a          aaa  u 
Get sequence
Deep sequencing
777713 reads, 97 experiments
Comments

Mouse miR-181b was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and independently in mouse [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 137966639-137966718 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-181b-1
mmu-mir-181a-1 chr1: 137966455-137966541 [+]
mmu-mir-181b-1 chr1: 137966639-137966718 [+]
Database links

Mature sequence mmu-miR-181b-5p

Accession MIMAT0000673
Previous IDs mmu-miR-181b
Sequence

12 - 

aacauucauugcugucggugggu

 - 34

Get sequence
Deep sequencing 1468783 reads, 82 experiments
Evidence experimental; cloned [2-4], Solexa [5,7]
Validated targets
Predicted targets

Mature sequence mmu-miR-181b-1-3p

Accession MIMAT0017067
Previous IDs mmu-miR-181b-1*
Sequence

52 - 

cucacugaacaaugaaugc

 - 70

Get sequence
Deep sequencing 5654 reads, 76 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).