Stem-loop sequence mmu-mir-138-1

AccessionMI0000722
Symbol MGI:Mir138-1
DescriptionMus musculus miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cucua   ug    u   -  a ag             uca       gc a 
5'      gca  gugu gug gg c  cugguguugugaa   ggccguu  c a
        |||  |||| ||| || |  |||||||||||||   |||||||  | u
3'      cgu  cacg cac cc g  gaccacaacacuu   ucggcaa  g c
   --gaa   --    u   a  - -g             -ca       ga a 
Get sequence
Deep sequencing
284971 reads, 1.32e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-138 was cloned from mouse brain tissue in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2]. mir-138-1 (MI0000722) is found on mouse chromosome 8, and mir-138-2 (MI0000164, previously named mir-138 here) on chromosome 9. Kim et al. and Obernosterer et al. independently show that the mature product is a 23mer [3,4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 122682876-122682974 [+]
intergenic
Database links

Mature sequence mmu-miR-138-5p

Accession MIMAT0000150
Previous IDsmmu-miR-138
Sequence

23 - 

agcugguguugugaaucaggccg

 - 45

Get sequence
Deep sequencing271461 reads, 88 experiments
Evidence experimental; cloned [1,5], Illumina [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-138-1-3p

Accession MIMAT0004668
Previous IDsmmu-miR-138*;mmu-miR-138-1*
Sequence

61 - 

cggcuacuucacaacaccaggg

 - 82

Get sequence
Deep sequencing1696 reads, 34 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
4
PMID:16738409 "Post-transcriptional regulation of microRNA expression" Obernosterer G, Leuschner PJ, Alenius M, Martinez J RNA. 12:1161-1167(2006).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).