Stem-loop sequence mmu-mir-9-1

AccessionMI0000720 (change log)
Symbol MGI:Mir9-1
DescriptionMus musculus miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

210 open access papers mention mmu-mir-9-1
(1074 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Deep sequencing
4165594 reads, 8.81e+03 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 88215598-88215686 [+]
sense
OTTMUST00000112727 ; RP23-168E14.7-003; intron 1
OTTMUST00000112771 ; RP23-168E14.7-011; intron 1
OTTMUST00000112728 ; RP23-168E14.7-004; intron 1
OTTMUST00000112725 ; RP23-168E14.7-001; intron 2
OTTMUST00000112726 ; RP23-168E14.7-002; intron 2
ENSMUST00000181396 ; Gm3764-004; intron 1
ENSMUST00000181356 ; Gm3764-011; intron 1
ENSMUST00000181636 ; Gm3764-003; intron 1
ENSMUST00000180582 ; Gm3764-002; intron 2
ENSMUST00000181550 ; Gm3764-001; intron 2
antisense
ENSMUST00000175135 ; Gm25641-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-9-1
mmu-mir-3093chr3: 88215171-88215257 [+]
mmu-mir-9-1chr3: 88215598-88215686 [+]
mmu-mir-9b-1chr3: 88215613-88215670 [-]
Database links

Mature sequence mmu-miR-9-5p

Accession MIMAT0000142
Previous IDsmmu-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing12049920 reads, 101 experiments
Evidence experimental; cloned [1-2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-9-3p

Accession MIMAT0000143
Previous IDsmmu-miR-9*
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing447406 reads, 82 experiments
Evidence experimental; cloned [1,4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).