Stem-loop sequence mmu-mir-19b-1

AccessionMI0000718 (change log)
Symbol MGI:Mir19b-1
DescriptionMus musculus miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Literature search

136 open access papers mention mmu-mir-19b-1
(771 sentences)

Stem-loop
       ggu                 -  -      uc    uguau 
5' cacu   cuaugguuaguuuugca gg uuugca  cagc     a
   ||||   ||||||||||||||||| || ||||||  ||||     a
3' gugg   ggugucagucaaaacgu cc aaacgu  gucg     u
       --u                 a  u      --    ucuua 
Get sequence
Deep sequencing
367032 reads, 2.79e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 115044305-115044391 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-19b-1
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-19b-1-5p

Accession MIMAT0017065
Previous IDsmmu-miR-19b-1*
Sequence

16 - 

aguuuugcagguuugcauccagc

 - 38

Get sequence
Deep sequencing500 reads, 60 experiments
Evidence experimental; 454 [7], Illumina [8]
Database links
Predicted targets

Mature sequence mmu-miR-19b-3p

Accession MIMAT0000513
Previous IDsmmu-miR-19b
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing736255 reads, 107 experiments
Evidence experimental; cloned [1-3,5], Northern [2], Illumina [6,8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).