Stem-loop sequence mmu-mir-124-1

Accession

MI0000716 (change log)

Previous IDs

mmu-mir-124a-1

Symbol

MGI:Mir124a-1

Description

Mus musculus miR-124-1 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Stem-loop

   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 

Deep sequencing

876077 reads, 1e+04 reads per million, 54 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MI0000716) on chromosome 14, mir-124-2 (MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MI0000150) on chromosome 2. All have closely related predicted human homologues (MI0000443, MI0000444 and MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr14: 64590657-64590741 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000180610 ; A930011O12Rik-201; exon 2

  ENSMUST00000181808 ; A930011O12Rik-202; exon 4

Clustered miRNAs

< 10kb from mmu-mir-124-1

• mmu-mir-124-1: chr14: 64590657-64590741 [+]
• mmu-mir-3078: chr14: 64591185-64591271 [+]

Database links

• EntrezGene:Mir124a-1
• MGI:Mir124a-1
• RNAcentral:URS000075A939_10090
• miRBase Tracker:MI0000716

Mature sequence mmu-miR-124-5p

• Accession: MIMAT0004527
• Previous IDs: mmu-miR-124*
• Sequence: 14 - cguguucacagcggaccuugau - 35
• Deep sequencing: 5935 reads, 24 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00003AA409_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-124-5p
  • miRDB:mmu-miR-124-5p
  • microrna.org:mmu-miR-124-5p

Mature sequence mmu-miR-124-3p

• Accession: MIMAT0000134
• Previous IDs: mmu-miR-124a;mmu-miR-124
• Sequence: 53 - uaaggcacgcggugaaugcc - 72
• Deep sequencing: 2622251 reads, 54 experiments
• Evidence: experimental; cloned [1-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS000020BE6A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-124-3p.1
  • miRDB:mmu-miR-124-3p
  • microrna.org:mmu-miR-124-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).