Stem-loop sequence mmu-mir-199b

Accession MI0000714
Symbol MGI:Mir199b
Description Mus musculus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cca    -auacc    cu  -     c       u        c   u  ----  a 
   gagg      ucca  cc gucua ccagugu uagacuac ugu ca    gg c
   ||||      ||||  || ||||| ||||||| |||||||| ||| ||    ||  
   cucc      gggu  gg cggau gguuaca gucugaug aca gu    cc u
-gg    cagauu    cg  u     u       c        -   u  uaaa  c 
Get sequence
Deep sequencing
2312231 reads, 97 experiments
Comments

Mouse miR-199b is predicted based on homology with the previously identified human miR-199b (MI0000282 ) [1,2]. Landgraf et al. later showed that the 3' product is the predominant one [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 32318460-32318569 [+]
antisense
OTTMUST00000031111 ; Dnm1-013; intron 1
OTTMUST00000031103 ; Dnm1-005; intron 14
OTTMUST00000031104 ; Dnm1-001; intron 15
OTTMUST00000031099 ; Dnm1-006; intron 15
OTTMUST00000031102 ; Dnm1-004; intron 15
OTTMUST00000031100 ; Dnm1-002; intron 15
OTTMUST00000031101 ; Dnm1-003; intron 15
ENSMUST00000129156 ; Dnm1-013; intron 1
ENSMUST00000091089 ; Dnm1-005; intron 14
ENSMUST00000113365 ; Dnm1-001; intron 15
ENSMUST00000139624 ; Dnm1-006; intron 15
ENSMUST00000078352 ; Dnm1-003; intron 15
ENSMUST00000113352 ; Dnm1-002; intron 15
ENSMUST00000113350 ; Dnm1-004; intron 15
Database links

Mature sequence mmu-miR-199b-5p

Accession MIMAT0000672
Previous IDs mmu-miR-199b;mmu-miR-199b*
Sequence

26 - 

cccaguguuuagacuaccuguuc

 - 48

Get sequence
Deep sequencing 185095 reads, 67 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-199b-3p

Accession MIMAT0004667
Previous IDs mmu-miR-199b
Sequence

65 - 

acaguagucugcacauugguua

 - 86

Get sequence
Deep sequencing 2124514 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).