Stem-loop sequence mmu-mir-199a-2

Accession MI0000713
Symbol MGI:Mir199a-2
Description Mus musculus miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
uggaa   uca  aga    -    c   gcc       u        c   --uca  ac 
     gcu   gg   uccu gcuc guc   ccagugu cagacuac ugu     gg  a
     |||   ||   |||| |||| |||   ||||||| |||||||| |||     ||   
     cga   cc   ggga cggg cag   gguuaca gucugaug aca     cc  a
----a   ---  ---    a    u   auu       c        -   uguug  gu
Get sequence
Deep sequencing
2316329 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 162217814-162217923 [+]
sense
OTTMUST00000073023 ; Dnm3os-001; exon 1
ENSMUST00000178978 ; Dnm3os-201; exon 1
ENSMUST00000139662 ; Dnm3os-001; exon 1
antisense
OTTMUST00000073179 ; Dnm3-004; intron 3
OTTMUST00000073178 ; Dnm3-003; intron 3
OTTMUST00000073176 ; Dnm3-001; intron 14
OTTMUST00000073026 ; Dnm3-006; intron 14
ENSMUST00000160665 ; Dnm3-004; intron 3
ENSMUST00000159763 ; Dnm3-003; intron 3
ENSMUST00000070330 ; Dnm3-006; intron 14
ENSMUST00000086074 ; Dnm3-001; intron 14
Clustered miRNAs
< 10kb from mmu-mir-199a-2
mmu-mir-199a-2 chr1: 162217814-162217923 [+]
mmu-mir-214 chr1: 162223368-162223477 [+]
Database links

Mature sequence mmu-miR-199a-5p

Accession MIMAT0000229
Previous IDs mmu-miR-199a
Sequence

31 -  

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing 188578 reads, 67 experiments
Evidence experimental; cloned [5], Solexa [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-199a-3p

Accession MIMAT0000230
Previous IDs mmu-miR-199a*
Sequence

70 -  

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing 2125160 reads, 82 experiments
Evidence experimental; cloned [1,5], Solexa [6-7]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
4
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).