Stem-loop sequence mmu-mir-29b-2

AccessionMI0000712 (change log)
Symbol MGI:Mir29b-2
DescriptionMus musculus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

337 open access papers mention mmu-mir-29b-2
(3331 sentences)

Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Deep sequencing
3452122 reads, 1.39e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 195037040-195037120 [+]
sense
ENSMUST00000083478 ; Mir29b-2-201; exon 1
ENSMUST00000181273 ; A330023F24Rik-202; exon 8
Clustered miRNAs
< 10kb from mmu-mir-29b-2
mmu-mir-29b-2chr1: 195037040-195037120 [+]
mmu-mir-29cchr1: 195037547-195037634 [+]
Database links

Mature sequence mmu-miR-29b-2-5p

Accession MIMAT0017063
Previous IDsmmu-miR-29b-2*
Sequence

11 - 

cugguuucacaugguggcuuagauu

 - 35

Get sequence
Deep sequencing8579 reads, 96 experiments
Evidence experimental; 454 [7], Illumina [8]
Database links
Predicted targets

Mature sequence mmu-miR-29b-3p

Accession MIMAT0000127
Previous IDsmmu-miR-29b
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Deep sequencing6885210 reads, 107 experiments
Evidence experimental; cloned [1,3,5], Illumina [6,8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).