Stem-loop sequence mmu-mir-224

Accession

MI0000711

Symbol

MGI:Mir224

Description

Mus musculus miR-224 stem-loop

Gene family

MIPF0000088; mir-224

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-224. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-224 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer.

Stem-loop

       ua         u   u      a u   ug  uu 
gggcuuu  agucacuag ggu ccguuu g aga  gu  g
|||||||  ||||||||| ||| |||||| | |||  ||   
cccgaaa  ucagugauc ccg gguaaa c uuu  ua  u
       ca         -   u      a -   gu  cg 

Deep sequencing

54468 reads, 74 experiments

Comments

Mouse mir-224 is predicted [2] based on homology to a cloned miR from human (MI0000301 ) [1]. Its expression was later verified by cloning [3].

Genome context

• Coordinates (GRCm38): chrX: 72261031-72261112 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000043189 ; Gabre-001; intron 6

  ENSMUST00000064780 ; Gabre-001; intron 6

Clustered miRNAs

< 10kb from mmu-mir-224

• mmu-mir-452: chrX: 72262224-72262308 [-]
• mmu-mir-224: chrX: 72261031-72261112 [-]

Database links

• ENTREZGENE: 723894;Mir224
• MGI: 3619129;Mir224

Mature sequence mmu-miR-224-5p

• Accession: MIMAT0000671
• Previous IDs: mmu-miR-224
• Sequence: 8 - uaagucacuagugguuccguu - 28
• Deep sequencing: 1825 reads, 61 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-224-5p
  • MICRORNA.ORG:mmu-miR-224-5p
  • MIRDB:mmu-miR-224-5p
  • RNA22-MMU:mmu-miR-224-5p
  • TARGETSCAN-VERT:mmu-miR-224

Mature sequence mmu-miR-224-3p

• Accession: MIMAT0017062
• Previous IDs: mmu-miR-224*
• Sequence: 55 - aaauggugcccuagugacuaca - 76
• Deep sequencing: 21 reads, 15 experiments
• Evidence: experimental; Solexa [5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-224-3p
  • MIRDB:mmu-miR-224-3p
  • RNA22-MMU:mmu-miR-224-3p

References

1. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).