Stem-loop sequence mmu-mir-221

Accession MI0000709
Symbol MGI:Mir221
Description Mus musculus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-221 microRNA (and it's paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a       cugg   a    -  ug   u         auuu    -   u 
 uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
 |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
 aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
a       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
1621457 reads, 97 experiments
Comments

Mouse mir-221 is predicted [2] based on homology to a reported miR from human (MI0000298 ) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 19146294-19146388 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-221
mmu-mir-222 chrX: 19146893-19146971 [-]
mmu-mir-221 chrX: 19146294-19146388 [-]
Database links

Mature sequence mmu-miR-221-5p

Accession MIMAT0017060
Previous IDs mmu-miR-221*
Sequence

20 - 

accuggcauacaauguagauuucugu

 - 45

Get sequence
Deep sequencing 25475 reads, 78 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

Mature sequence mmu-miR-221-3p

Accession MIMAT0000669
Previous IDs mmu-miR-221
Sequence

60 - 

agcuacauugucugcuggguuuc

 - 82

Get sequence
Deep sequencing 1048268 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4,6]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).