Stem-loop sequence mmu-mir-33

AccessionMI0000707 (change log)
Symbol MGI:Mir33
DescriptionMus musculus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                 a uu         guucu  c 
5' cuguggugcauugu g  gcauugcau     gg a
   |||||||||||||| |  |||||||||     || a
3' ggcacuacgugaca c  uguaacgug     cc u
                 c uu         ----u  a 
Get sequence
Deep sequencing
63710 reads, 511 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-33 is predicted [2] based on homology to a cloned miR from human (MI0000091) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 82198122-82198190 [+]
sense
ENSMUST00000023100 ; Srebf2-201; intron 16
Database links

Mature sequence mmu-miR-33-5p

Accession MIMAT0000667
Previous IDsmmu-miR-33
Sequence

6 - 

gugcauuguaguugcauugca

 - 26

Get sequence
Deep sequencing62802 reads, 76 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-33-3p

Accession MIMAT0004666
Previous IDsmmu-miR-33*
Sequence

46 - 

caauguuuccacagugcaucac

 - 67

Get sequence
Deep sequencing793 reads, 63 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).