![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-26a-2 |
||||||
Accession | MI0000706 (change log) | |||||
Symbol | MGI:Mir26a-2 | |||||
Description | Mus musculus miR-26a-2 stem-loop | |||||
Gene family | MIPF0000043; mir-26 | |||||
Literature search |
![]()
188 open access papers mention mmu-mir-26a-2 | |||||
Stem-loop |
g gg ug uu c -- uc 5' gcugc c ga caaguaauc aggauaggcu gug c ||||| | || ||||||||| |||||||||| ||| 3' cgacg g cu guucauuag ucuuguccgg uac g g ga gu uu u ag cu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence is a second predicted hairpin precursor for miR-26a (MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-26a-5p |
|
Accession | MIMAT0000533 |
Previous IDs | mmu-miR-26a |
Sequence |
14 - uucaaguaauccaggauaggcu - 35 |
Deep sequencing | 9687559 reads, 107 experiments |
Evidence | experimental; cloned [1-2,4-5], Illumina [6,8] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-26a-2-3p |
|
Accession | MIMAT0017058 |
Previous IDs | mmu-miR-26a-2* |
Sequence |
52 - ccuguucuugauuacuuguuuc - 73 |
Deep sequencing | 801 reads, 73 experiments |
Evidence | experimental; 454 [7], Illumina [8] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 | |
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
8 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|