Stem-loop sequence mmu-mir-26a-2

AccessionMI0000706
Symbol MGI:Mir26a-2
DescriptionMus musculus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g     gg ug  uu         c          --   uc 
5'  gcugc  c  ga  caaguaauc aggauaggcu  gug  c
    |||||  |  ||  ||||||||| ||||||||||  |||   
3'  cgacg  g  cu  guucauuag ucuuguccgg  uac  g
   g     ga gu  uu         u          ag   cu 
Get sequence
Deep sequencing
2987545 reads, 1.29e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a second predicted hairpin precursor for miR-26a (MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr10: 126995530-126995613 [+]
sense
ENSMUST00000105256 ; Ctdsp2-202; intron 5
Clustered miRNAs
< 10kb from mmu-mir-26a-2
mmu-mir-26a-2chr10: 126995530-126995613 [+]
mmu-mir-546chr10: 126998440-126998560 [+]
Database links

Mature sequence mmu-miR-26a-5p

Accession MIMAT0000533
Previous IDsmmu-miR-26a
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing2323017 reads, 92 experiments
Evidence experimental; cloned [1-2,4-5], Illumina [6,8]
Validated targets
Predicted targets

Mature sequence mmu-miR-26a-2-3p

Accession MIMAT0017058
Previous IDsmmu-miR-26a-2*
Sequence

52 - 

ccuguucuugauuacuuguuuc

 - 73

Get sequence
Deep sequencing153 reads, 50 experiments
Evidence experimental; 454 [7], Illumina [8]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).