Stem-loop sequence mmu-mir-26a-2

AccessionMI0000706 (change log)
Symbol MGI:Mir26a-2
DescriptionMus musculus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

188 open access papers mention mmu-mir-26a-2
(1996 sentences)

Stem-loop
   g     gg ug  uu         c          --   uc 
5'  gcugc  c  ga  caaguaauc aggauaggcu  gug  c
    |||||  |  ||  ||||||||| ||||||||||  |||   
3'  cgacg  g  cu  guucauuag ucuuguccgg  uac  g
   g     ga gu  uu         u          ag   cu 
Get sequence
Deep sequencing
4840536 reads, 1.3e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a second predicted hairpin precursor for miR-26a (MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 126995530-126995613 [+]
sense
ENSMUST00000105256 ; Ctdsp2-202; intron 5
Clustered miRNAs
< 10kb from mmu-mir-26a-2
mmu-mir-26a-2chr10: 126995530-126995613 [+]
mmu-mir-546chr10: 126998440-126998560 [+]
Database links

Mature sequence mmu-miR-26a-5p

Accession MIMAT0000533
Previous IDsmmu-miR-26a
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing9687559 reads, 107 experiments
Evidence experimental; cloned [1-2,4-5], Illumina [6,8]
Database links
Predicted targets

Mature sequence mmu-miR-26a-2-3p

Accession MIMAT0017058
Previous IDsmmu-miR-26a-2*
Sequence

52 - 

ccuguucuugauuacuuguuuc

 - 73

Get sequence
Deep sequencing801 reads, 73 experiments
Evidence experimental; 454 [7], Illumina [8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).