Stem-loop sequence mmu-mir-26a-2

Accession

MI0000706 (change log)

Symbol

MGI:Mir26a-2

Description

Mus musculus miR-26a-2 stem-loop

Gene family

MIPF0000043; mir-26

Literature search

188 open access papers mention mmu-mir-26a-2
(1996 sentences)

Stem-loop

   g     gg ug  uu         c          --   uc 
5'  gcugc  c  ga  caaguaauc aggauaggcu  gug  c
    |||||  |  ||  ||||||||| ||||||||||  |||   
3'  cgacg  g  cu  guucauuag ucuuguccgg  uac  g
   g     ga gu  uu         u          ag   cu 

Deep sequencing

4840536 reads, 1.3e+04 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a second predicted hairpin precursor for miR-26a (MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr10: 126995530-126995613 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000105256 ; Ctdsp2-202; intron 5

Clustered miRNAs

< 10kb from mmu-mir-26a-2

• mmu-mir-26a-2: chr10: 126995530-126995613 [+]
• mmu-mir-546: chr10: 126998440-126998560 [+]

Database links

• EntrezGene:Mirn26a-2
• MGI:Mir26a-2
• RNAcentral:URS000075E624_10090
• miRBase Tracker:MI0000706

Mature sequence mmu-miR-26a-5p

• Accession: MIMAT0000533
• Previous IDs: mmu-miR-26a
• Sequence: 14 - uucaaguaauccaggauaggcu - 35
• Deep sequencing: 9687559 reads, 107 experiments
• Evidence: experimental; cloned [1-2,4-5], Illumina [6,8]
• Database links:
  • RNAcentral:URS000019B0F7_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-26a-5p
  • miRDB:mmu-miR-26a-5p
  • microrna.org:mmu-miR-26a-5p

Mature sequence mmu-miR-26a-2-3p

• Accession: MIMAT0017058
• Previous IDs: mmu-miR-26a-2*
• Sequence: 52 - ccuguucuugauuacuuguuuc - 73
• Deep sequencing: 801 reads, 73 experiments
• Evidence: experimental; 454 [7], Illumina [8]
• Database links:
  • RNAcentral:URS000037536B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-26a-2-3p
  • miRDB:mmu-miR-26a-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).