Stem-loop sequence mmu-mir-320

Accession MI0000704
Symbol MGI:Mir320
Description Mus musculus miR-320 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
gccucg    --   ---c         uu       c      g 
      ccgc  ccu    cgccuucuc  cccgguu uucccg a
      ||||  |||    |||||||||  ||||||| ||||||  
      ggug  gga    gcgggagag  gggucga aagggc g
-----g    ua   aaaa         uu       a      u
Get sequence
Deep sequencing
1426008 reads, 97 experiments
Comments

Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MI0000542 ) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 70443510-70443591 [+]
intergenic
Database links

Mature sequence mmu-miR-320-5p

Accession MIMAT0017057
Previous IDs mmu-miR-320*
Sequence

16 -  

gccuucucuucccgguucuucc

 - 37

Get sequence
Deep sequencing 17 reads, 12 experiments
Evidence experimental; Solexa [6]
Predicted targets

Mature sequence mmu-miR-320-3p

Accession MIMAT0000666
Previous IDs mmu-miR-320
Sequence

48 -  

aaaagcuggguugagagggcga

 - 69

Get sequence
Deep sequencing 1234945 reads, 82 experiments
Evidence experimental; cloned [3-4], Solexa [5-6]
Validated targets
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).