Stem-loop sequence mmu-mir-223

AccessionMI0000703 (change log)
Symbol MGI:Mir223
DescriptionMus musculus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

185 open access papers mention mmu-mir-223
(2034 sentences)

Stem-loop
   u    ccaucu   -gu        cc u              gaguug         u 
5'  cugg      gca   gucacgcu  g guauuugacaagcu      gacacucug g
    ||||      |||   ||||||||  | ||||||||||||||      ||||||||| u
3'  gacu      cgu   cgguguga  c cauaaacuguuuga      cugugagau g
   -    ---auc   acu        ac c              ------         g 
Get sequence
Deep sequencing
588071 reads, 1.7e+03 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-223 is predicted [2] based on homology to a reported miR from human (MI0000300) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 96242817-96242926 [+]
sense
OTTMUST00000044608 ; RP23-23B17.2-002; exon 2
OTTMUST00000044607 ; RP23-23B17.2-001; exon 3
ENSMUST00000147681 ; F630028O10Rik-002; exon 2
ENSMUST00000133125 ; F630028O10Rik-001; exon 3
Database links

Mature sequence mmu-miR-223-5p

Accession MIMAT0017056
Previous IDsmmu-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguug

 - 48

Get sequence
Deep sequencing13863 reads, 88 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-223-3p

Accession MIMAT0000665
Previous IDsmmu-miR-223
Sequence

68 - 

ugucaguuugucaaauacccca

 - 89

Get sequence
Deep sequencing574187 reads, 96 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).