Stem-loop sequence mmu-mir-219a-1

AccessionMI0000702 (change log)
Symbol MGI:Mir219a-1
DescriptionMus musculus miR-219a-1 stem-loop
Gene family MIPF0000044; mir-219
Literature search

47 open access papers mention mmu-mir-219a-1
(456 sentences)

Stem-loop
   ---------ccguccc    c       cu   u     a            a   ucu 
5'                 gggc gcggcuc  gau gucca acgcaauucucg guc   g
                   |||| |||||||  ||| ||||| |||||||||||| |||   g
3'                 cccg cgccgag  cug caggu ugcguugagagc cgg   c
   gggggagcuccaaacc    c       cc   -     c            -   ccu 
Get sequence
Deep sequencing
37090 reads, 150 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 34024983-34025092 [-]
sense
OTTMUST00000095531 ; Mir219-1-001; exon 1
ENSMUST00000174851 ; Gm26940-001; exon 1
Clustered miRNAs
< 10kb from mmu-mir-219a-1
mmu-mir-219cchr17: 34025012-34025071 [+]
mmu-mir-219a-1chr17: 34024983-34025092 [-]
Database links

Mature sequence mmu-miR-219a-5p

Accession MIMAT0000664
Previous IDsmmu-miR-219
Sequence

21 - 

ugauuguccaaacgcaauucu

 - 41

Get sequence
Deep sequencing56690 reads, 91 experiments
Evidence experimental; Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-219a-1-3p

Accession MIMAT0017055
Previous IDsmmu-miR-219-3p*
Sequence

62 - 

agaguugcgucuggacgucccg

 - 83

Get sequence
Deep sequencing8711 reads, 86 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).