Stem-loop sequence mmu-mir-219-1

Accession MI0000702
Symbol MGI:Mir219-1
Description Mus musculus miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
---------ccguccc    c       cu   u     a            a   ucu 
                gggc gcggcuc  gau gucca acgcaauucucg guc   g
                |||| |||||||  ||| ||||| |||||||||||| |||   g
                cccg cgccgag  cug caggu ugcguugagagc cgg   c
gggggagcuccaaacc    c       cc   -     c            -   ccu
Get sequence
Deep sequencing
40051 reads, 96 experiments
Comments

Mouse mir-219 is predicted [2] based on homology to a reported miR from human (MI0000296 ) [1]. Its expression was later verified in mouse [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr17: 34024983-34025092 [-]
sense
OTTMUST00000095531 ; Mir219-1-001; exon 1
ENSMUST00000174851 ; Mir219-1-001; exon 1
Database links

Mature sequence mmu-miR-219-5p

Accession MIMAT0000664
Previous IDs mmu-miR-219
Sequence

21 -  

ugauuguccaaacgcaauucu

 - 41

Get sequence
Deep sequencing 64185 reads, 79 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-219-1-3p

Accession MIMAT0017055
Previous IDs mmu-miR-219-3p*
Sequence

62 -  

agaguugcgucuggacgucccg

 - 83

Get sequence
Deep sequencing 7298 reads, 66 experiments
Evidence experimental; Solexa [5]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).