|
miRBase |
|
Stem-loop sequence MI0000701 |
|||||
| Accession | MI0000701 | ||||
| ID | mmu-mir-218-2 | ||||
| Symbol | MGI:Mir218-2 | ||||
| Description | Mus musculus miR-218-2 stem-loop | ||||
| Stem-loop |
gac uu -cc gg uuu cu gguggaacga g cag g gcg gcuuucc gugcuugau aaccaugu ug a ||| | ||| ||||||| ||||||||| |||||||| || guc c cgc cgaaagg cacgaacug uugguaca gc a -ac cu ucu ua cgc uc --------ag a |
||||
| Comments |
Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000295 ) [1]. Its expression was later verified by cloning [3]. |
||||
| Genome context |
View flanking features |
||||
| Database links | |||||
| Gene family |
MIPF0000026; mir-218 |
||||
Mature sequence MIMAT0000663 |
|
| Accession | MIMAT0000663 |
| ID | mmu-miR-218 |
| Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
| Evidence | experimental; cloned [3], Solexa [4] |
| Predicted targets |
|
Minor miR* sequence MIMAT0005444 |
|
| Accession | MIMAT0005444 |
| ID | mmu-miR-218-2* |
| Sequence |
67 - caugguucugucaagcaccgcg - 88 |
| Evidence | experimental; cloned [3], Solexa [4] |
| Predicted targets |
|
References |
|
| 1 |
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
| 2 |
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. [Epub prior to print](2010).
|