Stem-loop sequence mmu-mir-218-2

Accession

MI0000701

Symbol

MGI:Mir218-2

Description

Mus musculus miR-218-2 stem-loop

Gene family

MIPF0000026; mir-218

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Stem-loop

gac   uu -cc   gg       uuu         cu        gguggaacga  g 
   cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
   |||  |   |||  |||||||   |||||||||  ||||||||          ||  
   guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
-ac   cu ucu   ua       cgc         uc        --------ag  a 

Deep sequencing

336092 reads, 74 experiments

Comments

Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000295 ) [1]. Its expression was later verified by cloning [3].

Genome context

• Coordinates (GRCm38): chr11: 35616816-35616925 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000012061 ; Slit3-001; intron 14

  ENSMUST00000069837 ; Slit3-001; intron 14

Database links

• ENTREZGENE: 723924;Mir218-2
• MGI: 3618752;Mir218-2

Mature sequence mmu-miR-218-5p

• Accession: MIMAT0000663
• Previous IDs: mmu-miR-218
• Sequence: 25 - uugugcuugaucuaaccaugu - 45
• Deep sequencing: 271128 reads, 55 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Validated targets:
  • TARBASE:mmu-miR-218-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-218-5p
  • MICRORNA.ORG:mmu-miR-218-5p
  • MIRDB:mmu-miR-218-5p
  • RNA22-MMU:mmu-miR-218-5p
  • TARGETSCAN-VERT:mmu-miR-218

Mature sequence mmu-miR-218-2-3p

• Accession: MIMAT0005444
• Previous IDs: mmu-miR-218-2*
• Sequence: 67 - caugguucugucaagcaccgcg - 88
• Deep sequencing: 711 reads, 37 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-218-2-3p
  • MICRORNA.ORG:mmu-miR-218-2-3p
  • MIRDB:mmu-miR-218-2-3p
  • RNA22-MMU:mmu-miR-218-2-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).