Stem-loop sequence MI0000701

Accession MI0000701
ID mmu-mir-218-2
Symbol MGI:Mir218-2
Description Mus musculus miR-218-2 stem-loop
Stem-loop
gac   uu -cc   gg       uuu         cu        gguggaacga  g 
   cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
   |||  |   |||  |||||||   |||||||||  ||||||||          ||  
   guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
-ac   cu ucu   ua       cgc         uc        --------ag  a 
Get sequence
Comments

Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000295 ) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
11: 35430318-35430427 [+]
sense
OTTMUST00000012061 ; Slit3-001; intron 14
ENSMUST00000069837 ; Slit3-001; intron 14

View flanking features
Database links
Gene family

MIPF0000026; mir-218

Mature sequence MIMAT0000663

Accession MIMAT0000663
ID mmu-miR-218
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence experimental; cloned [3], Solexa [4]
Predicted targets

Minor miR* sequence MIMAT0005444

Accession MIMAT0005444
ID mmu-miR-218-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Evidence experimental; cloned [3], Solexa [4]
Predicted targets

References

1
"Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. [Epub prior to print](2010).