Stem-loop sequence mmu-mir-214

AccessionMI0000698 (change log)
Symbol MGI:Mir214
DescriptionMus musculus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

120 open access papers mention mmu-mir-214
(1829 sentences)

Stem-loop
   ggccu      acaga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
137323 reads, 1.04e+03 reads per million, 87 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-214 is predicted [2] based on homology to a reported miR from human (MI0000290) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 162223368-162223477 [+]
sense
OTTMUST00000073023 ; Dnm3os-001; exon 1
ENSMUST00000139662 ; Dnm3os-001; exon 1
ENSMUST00000178978 ; Dnm3os-201; exon 1
antisense
OTTMUST00000073178 ; Dnm3-003; intron 3
OTTMUST00000073179 ; Dnm3-004; intron 3
OTTMUST00000073026 ; Dnm3-006; intron 14
OTTMUST00000073176 ; Dnm3-001; intron 14
ENSMUST00000160665 ; Dnm3-004; intron 3
ENSMUST00000159763 ; Dnm3-003; intron 3
ENSMUST00000070330 ; Dnm3-006; intron 14
ENSMUST00000086074 ; Dnm3-001; intron 14
Clustered miRNAs
< 10kb from mmu-mir-214
mmu-mir-199a-2chr1: 162217814-162217923 [+]
mmu-mir-214chr1: 162223368-162223477 [+]
Database links

Mature sequence mmu-miR-214-5p

Accession MIMAT0004664
Previous IDsmmu-miR-214*
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing41028 reads, 69 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-214-3p

Accession MIMAT0000661
Previous IDsmmu-miR-214
Sequence

71 - 

acagcaggcacagacaggcagu

 - 92

Get sequence
Deep sequencing93861 reads, 87 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).