Stem-loop sequence mmu-mir-212

AccessionMI0000696 (change log)
Symbol MGI:Mir212
DescriptionMus musculus miR-212 stem-loop
Gene family MIPF0000065; mir-132
Literature search

76 open access papers mention mmu-mir-212
(630 sentences)

Stem-loop
       -  c   c   -ca  u     cu      c      ccc  g 
5' gggc ag gcg cgg   cc uggcu  agacug uuacug   gg c
   |||| || ||| |||   || |||||  |||||| ||||||   ||  
3' cccg uc cgc gcc   gg acuga  ucugac aaugac   cc c
       g  -   a   acc  c     cc      -      -uu  g 
Get sequence
Deep sequencing
29436 reads, 57.3 reads per million, 110 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 75173388-75173478 [+]
sense
OTTMUST00000013960 ; RP23-143A14.3-001; intron 1
ENSMUST00000134252 ; 1700016P03Rik-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-212
mmu-mir-212chr11: 75173388-75173478 [+]
mmu-mir-132chr11: 75173682-75173747 [+]
Database links

Mature sequence mmu-miR-212-5p

Accession MIMAT0017053
Sequence

16 - 

accuuggcucuagacugcuuacu

 - 38

Get sequence
Deep sequencing17682 reads, 99 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-212-3p

Accession MIMAT0000659
Previous IDsmmu-miR-212
Sequence

56 - 

uaacagucuccagucacggcca

 - 77

Get sequence
Deep sequencing11753 reads, 99 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).