Stem-loop sequence mmu-mir-210

AccessionMI0000695 (change log)
Symbol MGI:Mir210
DescriptionMus musculus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

121 open access papers mention mmu-mir-210
(1255 sentences)

Stem-loop
   cc  gg -a  cc u     cu    a     a   cc   -      c  c   gc 
5'   gg  c  gu  c ccagg  cagg cagcc cug  cac cgcaca ug guu  u
     ||  |  ||  | |||||  |||| ||||| |||  ||| |||||| || |||   
3'   cc  g  cg  g ggucc  gucu gucgg gac  gug gcgugu ac cag  c
   --  aa cg  ac -     cu    a     c   -a   u      c  c   gc 
Get sequence
Deep sequencing
104812 reads, 254 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MI0000286) [1]. Its expression in mouse was later verified independently [2,4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 141221384-141221493 [-]
intergenic
Database links

Mature sequence mmu-miR-210-5p

Accession MIMAT0017052
Previous IDsmmu-miR-210*
Sequence

28 - 

agccacugcccaccgcacacug

 - 49

Get sequence
Deep sequencing3410 reads, 82 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-210-3p

Accession MIMAT0000658
Previous IDsmmu-miR-210
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing101347 reads, 107 experiments
Evidence experimental; cloned [2,4], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).