Stem-loop sequence mmu-mir-139

AccessionMI0000693
Symbol MGI:Mir139
DescriptionMus musculus miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
164178 reads, 442 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 101475376-101475443 [+]
sense
ENSMUST00000163751 ; Pde2a-202; intron 2
ENSMUST00000084894 ; Pde2a-201; intron 2
ENSMUST00000166652 ; Pde2a-203; intron 2
Database links

Mature sequence mmu-miR-139-5p

Accession MIMAT0000656
Previous IDsmmu-miR-139
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Deep sequencing66338 reads, 82 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-139-3p

Accession MIMAT0004662
Sequence

43 - 

uggagacgcggcccuguuggag

 - 64

Get sequence
Deep sequencing32195 reads, 71 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).