Stem-loop sequence mmu-mir-100

AccessionMI0000692 (change log)
Symbol MGI:Mir100
DescriptionMus musculus miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       -uu c    a   cg    uc   a      c  au 
5' ccug   g caca acc  uaga  cga cuugug ug  u
   ||||   | |||| |||  ||||  ||| |||||| ||   
3' ggau   c gugu ugg  aucu  guu gaacac ac  c
       ugu u    a   au    gu   c      -  gu 
Get sequence
Deep sequencing
189697 reads, 2.02e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MI0000102) [1]. Its expression was later verified in mouse [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 41531425-41531504 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-100
mmu-mir-100chr9: 41531425-41531504 [+]
mmu-let-7a-2chr9: 41536716-41536811 [+]
Database links

Mature sequence mmu-miR-100-5p

Accession MIMAT0000655
Previous IDsmmu-miR-100
Sequence

13 - 

aacccguagauccgaacuugug

 - 34

Get sequence
Deep sequencing189192 reads, 76 experiments
Evidence experimental; cloned [3], Illumina [4,6]
Database links
Predicted targets

Mature sequence mmu-miR-100-3p

Accession MIMAT0017051
Previous IDsmmu-miR-100*
Sequence

47 - 

acaagcuugugucuauagguau

 - 68

Get sequence
Deep sequencing505 reads, 37 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).