Stem-loop sequence mmu-mir-100

Accession

MI0000692

Symbol

MGI:Mir100

Description

Mus musculus miR-100 stem-loop

Gene family

MIPF0000025; mir-99

Stem-loop

    -uu c    a   cg    uc   a      c  au 
ccug   g caca acc  uaga  cga cuugug ug  u
||||   | |||| |||  ||||  ||| |||||| ||   
ggau   c gugu ugg  aucu  guu gaacac ac  c
    ugu u    a   au    gu   c      -  gu 

Deep sequencing

reads, experiments

Comments

Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MI0000102 ) [1]. Its expression was later verified in mouse [3].

Genome context

• Coordinates (GRCm38): chr9: 41531425-41531504 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-100

• mmu-mir-100: chr9: 41531425-41531504 [+]
• mmu-let-7a-2: chr9: 41536716-41536811 [+]

Database links

• ENTREZGENE: 723892;Mir100
• MGI: 3619057;Mir100

Mature sequence mmu-miR-100-5p

• Accession: MIMAT0000655
• Previous IDs: mmu-miR-100
• Sequence: 13 - aacccguagauccgaacuugug - 34
• Evidence: experimental; cloned [3], Solexa [4,6]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-100-5p
  • MICRORNA.ORG:mmu-miR-100-5p
  • MIRDB:mmu-miR-100-5p
  • RNA22-MMU:mmu-miR-100-5p
  • TARGETSCAN-VERT:mmu-miR-100

Mature sequence mmu-miR-100-3p

• Accession: MIMAT0017051
• Previous IDs: mmu-miR-100*
• Sequence: 47 - acaagcuugugucuauagguau - 68
• Evidence: experimental; 454 [5], Solexa [6]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-100-3p
  • MIRDB:mmu-miR-100-3p
  • RNA22-MMU:mmu-miR-100-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).