Stem-loop sequence mmu-mir-32

AccessionMI0000691 (change log)
Symbol MGI:Mir32
DescriptionMus musculus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Deep sequencing
9078 reads, 88.2 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-32 is predicted [3] based on homology to a cloned miR from human (MI0000090) [1]. Its expression in mouse was later independently verified [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 56895229-56895298 [-]
sense
OTTMUST00000016919 ; Tmem245-003; intron 8
OTTMUST00000016920 ; Tmem245-004; intron 12
OTTMUST00000016917 ; Tmem245-001; intron 14
OTTMUST00000016918 ; Tmem245-002; intron 14
ENSMUST00000132816 ; Tmem245-003; intron 8
ENSMUST00000125082 ; Tmem245-004; intron 12
ENSMUST00000068792 ; Tmem245-001; intron 14
ENSMUST00000155625 ; Tmem245-002; intron 14
ENSMUST00000107609 ; Tmem245-201; intron 14
Database links

Mature sequence mmu-miR-32-5p

Accession MIMAT0000654
Previous IDsmmu-miR-32
Sequence

6 - 

uauugcacauuacuaaguugca

 - 27

Get sequence
Deep sequencing8620 reads, 76 experiments
Evidence experimental; cloned [2,4], Illumina [5,7]
Database links
Predicted targets

Mature sequence mmu-miR-32-3p

Accession MIMAT0017050
Previous IDsmmu-miR-32*
Sequence

47 - 

caauuuagugugugugauauu

 - 67

Get sequence
Deep sequencing335 reads, 55 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).