Stem-loop sequence mmu-mir-28a

AccessionMI0000690 (change log)
Previous IDsmmu-mir-28
Symbol MGI:Mir28a
DescriptionMus musculus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

22 open access papers mention mmu-mir-28a
(158 sentences)

Stem-loop
      c   a     a  g             ----uu     gcc 
5' ggu ccu ccuuc ag agcucacagucua      gaguu   u
   ||| ||| ||||| || |||||||||||||      |||||    
3' uca gga gggag uc ucgaguguuagau      cuuag   u
      c   c     g  g             cacccu     ucu 
Get sequence
Deep sequencing
305696 reads, 770 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-28 is predicted [2] based on homology to a cloned miR from human (MI0000086) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 24827855-24827940 [+]
sense
ENSMUST00000115314 ; Lpp-203; intron 3
ENSMUST00000078988 ; Lpp-202; intron 7
ENSMUST00000038053 ; Lpp-201; intron 8
Database links

Mature sequence mmu-miR-28a-5p

Accession MIMAT0000653
Previous IDsmmu-miR-28;mmu-miR-28-5p
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing197001 reads, 107 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-28a-3p

Accession MIMAT0004661
Previous IDsmmu-miR-28*;mmu-miR-28-3p
Sequence

54 - 

cacuagauugugagcugcugga

 - 75

Get sequence
Deep sequencing108687 reads, 106 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).