Stem-loop sequence mmu-mir-28a

Accession MI0000690
Previous IDs mmu-mir-28
Symbol MGI:Mir28
Description Mus musculus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
   c   a     a  g             ----uu     gcc 
ggu ccu ccuuc ag agcucacagucua      gaguu   u
||| ||| ||||| || |||||||||||||      |||||    
uca gga gggag uc ucgaguguuagau      cuuag   u
   c   c     g  g             cacccu     ucu 
Get sequence
Deep sequencing
121778 reads, 97 experiments
Comments

Mouse mir-28 is predicted [2] based on homology to a cloned miR from human (MI0000086 ) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 24827855-24827940 [+]
sense
ENSMUST00000115314 ; Lpp-203; intron 3
ENSMUST00000078988 ; Lpp-202; intron 7
ENSMUST00000038053 ; Lpp-201; intron 8
Database links

Mature sequence mmu-miR-28a-5p

Accession MIMAT0000653
Previous IDs mmu-miR-28;mmu-miR-28-5p
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing 45808 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-28a-3p

Accession MIMAT0004661
Previous IDs mmu-miR-28*;mmu-miR-28-3p
Sequence

54 - 

cacuagauugugagcugcugga

 - 75

Get sequence
Deep sequencing 21363 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).