Stem-loop sequence mmu-mir-28a

AccessionMI0000690 (change log)
Previous IDsmmu-mir-28
Symbol MGI:Mir28a
DescriptionMus musculus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
      c   a     a  g             ----uu     gcc 
5' ggu ccu ccuuc ag agcucacagucua      gaguu   u
   ||| ||| ||||| || |||||||||||||      |||||    
3' uca gga gggag uc ucgaguguuagau      cuuag   u
      c   c     g  g             cacccu     ucu 
Get sequence
Deep sequencing
75832 reads, 470 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-28 is predicted [2] based on homology to a cloned miR from human (MI0000086) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 24827855-24827940 [+]
sense
ENSMUST00000115314 ; Lpp-203; intron 3
ENSMUST00000078988 ; Lpp-202; intron 7
ENSMUST00000038053 ; Lpp-201; intron 8
Database links

Mature sequence mmu-miR-28a-5p

Accession MIMAT0000653
Previous IDsmmu-miR-28;mmu-miR-28-5p
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing52714 reads, 76 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-28a-3p

Accession MIMAT0004661
Previous IDsmmu-miR-28*;mmu-miR-28-3p
Sequence

54 - 

cacuagauugugagcugcugga

 - 75

Get sequence
Deep sequencing23116 reads, 76 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).