Stem-loop sequence mmu-mir-25

AccessionMI0000689 (change log)
Symbol MGI:Mir25
DescriptionMus musculus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Deep sequencing
3174511 reads, 1.02e+04 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-25 is predicted [3] based on homology to a cloned miR from human (MI0000082) [1]. Its expression has been later independently verified in mouse [2,4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 138165321-138165404 [-]
sense
OTTMUST00000054336 ; Mcm7-010; exon 1
OTTMUST00000054328 ; Mcm7-002; intron 8
OTTMUST00000054327 ; Mcm7-001; intron 13
ENSMUST00000125316 ; Mcm7-010; exon 1
ENSMUST00000148879 ; Mcm7-002; intron 8
ENSMUST00000000505 ; Mcm7-001; intron 13
Clustered miRNAs
< 10kb from mmu-mir-25
mmu-mir-106bchr5: 138165737-138165818 [-]
mmu-mir-93chr5: 138165523-138165610 [-]
mmu-mir-25chr5: 138165321-138165404 [-]
Database links

Mature sequence mmu-miR-25-5p

Accession MIMAT0017049
Previous IDsmmu-miR-25*
Sequence

14 - 

aggcggagacuugggcaauugc

 - 35

Get sequence
Deep sequencing95480 reads, 64 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-25-3p

Accession MIMAT0000652
Previous IDsmmu-miR-25
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing3078929 reads, 76 experiments
Evidence experimental; cloned [2,4], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).