Stem-loop sequence mmu-mir-19a

AccessionMI0000688 (change log)
Symbol MGI:Mir19a
DescriptionMus musculus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

140 open access papers mention mmu-mir-19a
(762 sentences)

Stem-loop
       c  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
317097 reads, 2.5e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 115044000-115044081 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-19a
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-19a-5p

Accession MIMAT0004660
Previous IDsmmu-miR-19a*
Sequence

13 - 

uaguuuugcauaguugcacuac

 - 34

Get sequence
Deep sequencing748 reads, 58 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-19a-3p

Accession MIMAT0000651
Previous IDsmmu-miR-19a
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing316334 reads, 107 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).