Stem-loop sequence mmu-mir-17

AccessionMI0000687 (change log)
Symbol MGI:Mir17
DescriptionMus musculus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

321 open access papers mention mmu-mir-17
(3129 sentences)

Stem-loop
        a       -ca       ua  g     guagu    u 
5' gucag auaaugu   aagugcu  ca ugcag     gaug g
   ||||| |||||||   |||||||  || |||||     ||||  
3' caguc uauuacg   uucacgg  gu acguc     cuac u
        g       aug       ga  g     ---au    g 
Get sequence
Deep sequencing
364345 reads, 2e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-17 is predicted [4] based on homology to a cloned miR from human (MI0000071) [1,2]. miRNAs derived from the 5' [1] and 3' [2] arms of the human mir-17 precursor have been reported. Landgraf et al. show that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 115043671-115043754 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-17
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-17-5p

Accession MIMAT0000649
Previous IDsmmu-miR-17-5p;mmu-miR-17
Sequence

14 - 

caaagugcuuacagugcagguag

 - 36

Get sequence
Deep sequencing306212 reads, 107 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-17-3p

Accession MIMAT0000650
Previous IDsmmu-miR-17-3p;mmu-miR-17*
Sequence

51 - 

acugcagugagggcacuuguag

 - 72

Get sequence
Deep sequencing58132 reads, 104 experiments
Evidence experimental; cloned [3,5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).