Stem-loop sequence mmu-mir-10a

AccessionMI0000685 (change log)
Previous IDsmmu-mir-10a-1
Symbol MGI:Mir10a
DescriptionMus musculus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

117 open access papers mention mmu-mir-10a
(912 sentences)

Stem-loop
   -----gacc   --c    uu        a    g     c          uaaggaa 
5'          ugu   uguc  cuguauau cccu uagau cgaauuugug       u
            |||   ||||  |||||||| |||| ||||| ||||||||||        
3'          aca   acag  gauguaua gggg aucua gcuuaaacac       u
   acucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
17956515 reads, 2.21e+04 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 96317165-96317274 [+]
sense
OTTMUST00000003562 ; Hoxb4-001; 3'UTR (exon 1)
ENSMUST00000049241 ; Hoxb4-001; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-10a-5p

Accession MIMAT0000648
Previous IDsmmu-miR-10a
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing17949522 reads, 109 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-10a-3p

Accession MIMAT0004659
Previous IDsmmu-miR-10a*
Sequence

63 - 

caaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing6874 reads, 86 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).