miRNA Entry for MI0000684

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

mir-103/107 microRNA precursor

Predicted secondary structure and sequence conservation of mir-103
Identifiers
Symbol	mir-103
Rfam	RF00129
miRBase	MI0000109
miRBase family	MIPF0000024
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human.^[1]^[2]

microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.^[3]

mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes.^[4]

mir-103 has also been linked with chronic pain^[5] and intestinal cell proliferation.^[6]

[edit] References

^ Mourelatos Z, Dostie J, Paushkin S et al. (2002). "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs". Genes Dev. 16 (6): 720–8. doi:10.1101/gad.974702. PMC 155365. PMID 11914277. //www.ncbi.nlm.nih.gov/pmc/articles/PMC155365/.
^ "miRNA gene family: mir-103". mirBASE. University of Manchester. http://microrna.sanger.ac.uk/cgi-bin/sequences/mirna_summary.pl?fam=MIPF0000024. Retrieved 5 September 2011.
^ Ambros V (2001). "microRNAs: tiny regulators with great potential". Cell 107 (7): 823–6. doi:10.1016/S0092-8674(01)00616-X. PMID 11779458.
^ Trajkovski, M; Hausser, J, Soutschek, J, Bhat, B, Akin, A, Zavolan, M, Heim, MH, Stoffel, M (2011 Jun 8). "MicroRNAs 103 and 107 regulate insulin sensitivity". Nature 474 (7353): 649–53. doi:10.1038/nature10112. PMID 21654750.
^ Favereaux, A; Thoumine, O, Bouali-Benazzouz, R, Roques, V, Papon, MA, Salam, SA, Drutel, G, Léger, C, Calas, A, Nagy, F, Landry, M (2011 Jul 29). "Bidirectional integrative regulation of Cav1.2 calcium channel by microRNA miR-103: role in pain". The EMBO Journal 30 (18): 3830–41. doi:10.1038/emboj.2011.249. PMID 21804529.
^ Liao, Y; Lönnerdal, B (2010 Sep 23). Langsley, Gordon. ed. "Global MicroRNA Characterization Reveals That miR-103 Is Involved in IGF-1 Stimulated Mouse Intestinal Cell Proliferation". PLoS ONE 5 (9): e12976. doi:10.1371/journal.pone.0012976. PMC 2944884. PMID 20886090. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2944884/.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence mmu-miR-107-5p
Accession	MIMAT0017048
Previous IDs	mmu-miR-107*
Sequence	15 - agcuucuuuacaguguugccuug - 37 Get sequence
Deep sequencing	808 reads, 66 experiments
Evidence	experimental; 454 [6], Solexa [7]
Predicted targets	DIANA-MICROT:mmu-miR-107-5p MIRDB:mmu-miR-107-5p RNA22-MMU:mmu-miR-107-5p

Mature sequence mmu-miR-107-3p
Accession	MIMAT0000647
Previous IDs	mmu-miR-107
Sequence	52 - agcagcauuguacagggcuauca - 74 Get sequence
Deep sequencing	5886412 reads, 82 experiments
Evidence	experimental; cloned [3-4], Solexa [5,7]
Predicted targets	DIANA-MICROT:mmu-miR-107-3p MICRORNA.ORG:mmu-miR-107-3p MIRDB:mmu-miR-107-3p RNA22-MMU:mmu-miR-107-3p TARGETSCAN-VERT:mmu-miR-107

References
1	PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2	PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3	PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5	PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6	PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7	PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).

miRBase

Stem-loop sequence mmu-mir-107

[edit] References

[edit] External links

Mature sequence mmu-miR-107-5p

Mature sequence mmu-miR-107-3p

References