miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000684

Accession MI0000684
ID mmu-mir-107
Symbol MGI:Mir107
Description Mus musculus miR-107 stem-loop
Stem-loop 
-             --c    u  u           c   u   a 
 uucucugugcuuu   agcu cu uacaguguugc uug ggc u
 |||||||||||||   |||| || ||||||||||| ||| ||| g
 gagagacacgaaa   ucgg ga auguuacgacg aac uug g
c             cua    -  c           -   -   a
Get sequence
Comments

Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MI0000114 ) [1], and later verified in mouse [3,4].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
19: 34895177-34895263 [-]
sense
ENSMUST00000112460 ; Pank1-202; intron 5
ENSMUST00000036584 ; Pank1-201; intron 5

View flanking features
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000647

Accession MIMAT0000647
ID mmu-miR-107
Sequence

52 -  

agcagcauuguacagggcuauca

 - 74

Get sequence
Evidence experimental; cloned [3-4]
Predicted targets

References

1
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
"New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).