Stem-loop sequence mmu-mir-107

Accession MI0000684
Symbol MGI:Mir107
Description Mus musculus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-             --c    u  u           c   u   a 
 uucucugugcuuu   agcu cu uacaguguugc uug ggc u
 |||||||||||||   |||| || ||||||||||| ||| ||| g
 gagagacacgaaa   ucgg ga auguuacgacg aac uug g
c             cua    -  c           -   -   a 
Get sequence
Deep sequencing
7680645 reads, 97 experiments
Comments

Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MI0000114 ) [1], and later verified in mouse [3,4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr19: 34820687-34820773 [-]
sense
ENSMUST00000112460 ; Pank1-202; intron 5
ENSMUST00000036584 ; Pank1-201; intron 5
Database links

Mature sequence mmu-miR-107-5p

Accession MIMAT0017048
Previous IDs mmu-miR-107*
Sequence

15 - 

agcuucuuuacaguguugccuug

 - 37

Get sequence
Deep sequencing 808 reads, 66 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

Mature sequence mmu-miR-107-3p

Accession MIMAT0000647
Previous IDs mmu-miR-107
Sequence

52 - 

agcagcauuguacagggcuauca

 - 74

Get sequence
Deep sequencing 5886412 reads, 82 experiments
Evidence experimental; cloned [3-4], Solexa [5,7]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).