Stem-loop sequence hsa-mir-155

Accession MI0000681
Symbol HGNC:MIR155
Description Homo sapiens miR-155 stem-loop
Gene family MIPF0000157; mir-155
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-155. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MiR-155 is a microRNA that in humans is encoded by the MIR155 host gene or MIR155HG. MiR-155 plays an important role in various physiological and pathological processes. Exogenous molecular control in vivo of miR-155 expression may inhibit malignant growth, viral infections, and attenuate the progression of cardiovascular diseases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
              c   a        -u   c 
cuguuaaugcuaau gug uagggguu  uug c
|||||||||||||| ||| ||||||||  |||  
gacaauuacgauua uac auccucag  aac u
              -   -        uc   c 
Get sequence
Deep sequencing
1942 reads, 14 experiments
Comments

Human mir-155 is predicted based on homology to a cloned miR from mouse (MI0000177 ) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr21: 26946292-26946356 [+]
sense
OTTHUMT00000171187 ; MIR155HG-001; exon 4
OTTHUMT00000171187 ; MIR155HG-001; exon 4
OTTHUMT00000171187 ; MIR155HG-001; exon 4
ENST00000456917 ; MIR155HG-001; exon 4
ENST00000456917 ; MIR155HG-001; exon 4
ENST00000456917 ; MIR155HG-001; exon 4
Database links

Mature sequence hsa-miR-155-5p

Accession MIMAT0000646
Previous IDs hsa-miR-155
Sequence

4 - 

uuaaugcuaaucgugauaggggu

 - 26

Get sequence
Deep sequencing 1934 reads, 14 experiments
Evidence experimental; cloned [2,5-7]
Validated targets
Predicted targets

Mature sequence hsa-miR-155-3p

Accession MIMAT0004658
Previous IDs hsa-miR-155*
Sequence

43 - 

cuccuacauauuagcauuaaca

 - 64

Get sequence
Deep sequencing 8 reads, 3 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
PMID:15738415 "Accumulation of miR-155 and BIC RNA in human B cell lymphomas" Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE Proc Natl Acad Sci U S A. 102:3627-3632(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).