Stem-loop sequence hsa-mir-155

AccessionMI0000681 (change log)
Symbol HGNC:MIR155
DescriptionHomo sapiens miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

1009 open access papers mention hsa-mir-155
(8229 sentences)

Stem-loop
                 c   a        -u   c 
5' cuguuaaugcuaau gug uagggguu  uug c
   |||||||||||||| ||| ||||||||  |||  
3' gacaauuacgauua uac auccucag  aac u
                 -   -        uc   c 
Get sequence
Deep sequencing
177884 reads, 356 reads per million, 149 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Human mir-155 is predicted based on homology to a cloned miR from mouse (MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 25573980-25574044 [+]
intergenic
Database links

Mature sequence hsa-miR-155-5p

Accession MIMAT0000646
Previous IDshsa-miR-155
Sequence

4 - 

uuaaugcuaaucgugauagggguu

 - 27

Get sequence
Deep sequencing177692 reads, 149 experiments
Evidence experimental; cloned [2,5-7]
Database links
Predicted targets

Mature sequence hsa-miR-155-3p

Accession MIMAT0004658
Previous IDshsa-miR-155*
Sequence

43 - 

cuccuacauauuagcauuaaca

 - 64

Get sequence
Deep sequencing192 reads, 28 experiments
Evidence experimental; cloned [5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
4
PMID:15738415 "Accumulation of miR-155 and BIC RNA in human B cell lymphomas" Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE Proc Natl Acad Sci U S A. 102:3627-3632(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).