|
miRBase |
|
Stem-loop sequence osa-MIR171a |
|||||
| Accession | MI0000680 | ||||
| Previous IDs | osa-MIR171 | ||||
| Description | Oryza sativa miR171a stem-loop | ||||
| Gene family | MIPF0000030; MIR171_1 | ||||
| Stem-loop |
--- a gc a c g ag ggaa ga gauauuggug gguucaauc gau auugguuuuac c |||| || |||||||||| ||||||||| ||| ||||||||||| a ccuu cu cuauaaccgc ccgaguuag cua ugacuaaaaug g ucu - -- g u - gu |
||||
| Deep sequencing |
| ||||
| Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
| Genome context |
|
||||
Mature sequence osa-miR171a |
|
| Accession | MIMAT0000645 |
| Sequence |
67 - ugauugagccgcgccaauauc - 87 |
| Deep sequencing | 2174 reads, 4 experiments |
| Evidence | by similarity; MI0000214 |
References |
|
| 1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|