Stem-loop sequence osa-MIR171a

AccessionMI0000680 (change log)
Previous IDsosa-MIR171
DescriptionOryza sativa miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

48 open access papers mention osa-MIR171a
(164 sentences)

Stem-loop
   ---    a  gc          a         c   g           ag 
5'    ggaa ga  gauauuggug gguucaauc gau auugguuuuac  c
      |||| ||  |||||||||| ||||||||| ||| |||||||||||  a
3'    ccuu cu  cuauaaccgc ccgaguuag cua ugacuaaaaug  g
   ucu    -  --          g         u   -           gu 
Get sequence
Deep sequencing
575 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 25891132-25891227 [+]
intergenic
Database links

Mature sequence osa-miR171a

Accession MIMAT0000645
Sequence

67 - 

ugauugagccgcgccaauauc

 - 87

Get sequence
Deep sequencing569 reads, 2 experiments
Evidence by similarity; MI0000214
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).