Stem-loop sequence osa-MIR167c

AccessionMI0000678 (change log)
DescriptionOryza sativa miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

82 open access papers mention osa-MIR167c
(254 sentences)

Stem-loop
   u      ----     c      a      --             ucuga       a      ------gu    -----     cug 
5'  guccaa    gggaa gaguga gcugcc  agcaugaucuagc     augauca caagau        gcuc     ccaca   c
    ||||||    ||||| |||||| ||||||  |||||||||||||     ||||||| ||||||        ||||     |||||   c
3'  cggguu    cccuu uucacu cgacgg  ucguacuggaucg     uacuggu guucug        cgag     ggugu   u
   a      guua     c      c      cg             uuccg       -      aucguugu    uucua     ccu 
Get sequence
Deep sequencing
86684 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 33130619-33130781 [+]
intergenic
Database links

Mature sequence osa-miR167c-5p

Accession MIMAT0000643
Previous IDsosa-miR167c
Sequence

17 - 

ugaagcugccagcaugaucua

 - 37

Get sequence
Deep sequencing86656 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

Mature sequence osa-miR167c-3p

Accession MIMAT0022860
Sequence

123 - 

ggucaugcugcggcagccucacu

 - 145

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).