Stem-loop sequence osa-MIR167b

AccessionMI0000677 (change log)
DescriptionOryza sativa miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

83 open access papers mention osa-MIR167b
(251 sentences)

Stem-loop
           g  -a   -c         - -               --u  ag  -a    auc   -      c    g    ga 
5' gugcccaa ag  aag  gugaagcug c cagcaugaucuaacu   gc  ac  agaa   agc ucagcu gcug uuuc  a
   |||||||| ||  |||  ||||||||| | |||||||||||||||   ||  ||  ||||   ||| |||||| |||| ||||   
3' cacggguu uc  uuc  cacuuugac g gucguacuagauugg   ug  ug  ucuu   ucg agucga cggc gaag  c
           g  cc   cu         a u               uag  ca  ag    -cu   g      u    g    ga 
Get sequence
Deep sequencing
86907 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 30546928-30547090 [-]
intergenic
Database links

Mature sequence osa-miR167b

Accession MIMAT0000642
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Deep sequencing86903 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).