Stem-loop sequence osa-MIR166f

AccessionMI0000675 (change log)
DescriptionOryza sativa miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

70 open access papers mention osa-MIR166f
(257 sentences)

Stem-loop
   -    cauc        a      uc      c          a    a   gu 
5'  cgau    uuguugag ggaaug  gucugg cugagaucgu ccac gug  g
    ||||    |||||||| ||||||  |||||| |||||||||| |||| |||  g
3'  gcug    aacaacuc ccuuac  cggacc ggcucuggca ggug cac  g
   g    -cuc        c      uu      a          -    -   au 
Get sequence
Deep sequencing
36916 reads, 2.43e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 14483290-14483396 [-]
intergenic
Database links

Mature sequence osa-miR166f

Accession MIMAT0000640
Sequence

72 - 

ucggaccaggcuucauucccc

 - 92

Get sequence
Deep sequencing36912 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).